Cavia_porcellus Locus Mono:298:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:298:SNORA2
Cavia_porcellus
Mono:298:SNORA2
scaffold_249378
SNORA2
1001..1115
2115
GAACACGGACCTCCACCCATGGGCTGAGGAAGGCCATTCAGAAATCTATTAGAGGGGAG
GCTGGCTTGGCAGTTTTCATGCCACACTGTAGGGGACTCATAACTGAATTTTAAAAATGT
ACTGAGTTCACAGAAAAGAGAATTAAGTATAGCAGGGGTTCACTCTGAACATTAATCTCA
GAAGCCAACTCCTTCATTTCAAGCAAGGCCTTCAATACAAGGAGTCCCCTGACCTTCTTT
CCTTTTGCACAGATAGCTCTGCCAAAGCCTGCCCCACTGAGAGGGAGGAGCACGAATGTA
AATTGTAGGCCCTTAAAGGCCCACTCAGGACCAAGACCTGGTTTTGTTATGGCAACAAAT
GCTATTTGTTCTTCTGTATGGCTTTAAGATTCCTTCTCCTACCAGATTCCCAGCTTTTTA
TAATAGAAAACGGCCTCATCTAAGAAGCTCAGTCATTCAGTAGTGATTTACACAGAAGAT
TGCCAACATAAAAGTGCTAATATTTAATAAGTGCTTACCAGAGTACTTGCCCAACACAGG
CTGTGAGCTTTTCATGCCTTAGCTGTGTAATCCTCACAACCCACCGTGAGGTACACACTG
TGTATGCACTTTAGAGATGAACAGACCAAAGCACAGGGGACCTGAGTGATCCTGCCCAGA
ACCCAAATCAGAAAGCAGCCCTACTTGACTTTAATCCAGGCATCCCGTTTCAAAGTCCAT
GGTCTCAACCATGGAATCCCATAGCCTTGAAAAATCTATGTCTTGATTGTGCTATATAGG
GAGTGTTTGTTCTGCTGATGATATTCTCGGTGTATGAACAATGTCTGGTCAGGATGGTGG
GGCACTTAGAAGGTTGAGGCAGGAGATTGCCATGAGTTTGAGGTCAGACCAGGTTACACA
GTGAGTTCAATGTCAGCCTGAACTACGTAGTGAGACCCTGTTCCTCCCCCCCCAAAAATA
AAAAAAAAAAAAAGAAAACAAATTCTAGTTTATGCAATGCAATGGTTCTGAATTAAGGCC
GGCAGCTTTCTGAAGCTGTTCGTTTCAAGGAGCCCAAAGTGATGTCTTTCTATGTCTGTC
GGTCATTTCAGATCAATTCATTAGAAAGAACTCCCCCACCATAAGCCACCCCCAACCATG
AGCCCAGCAAAGCAGACTGGAGATGAAGAAGCCTAAGGGGTTCTGCTGCCATCAGGGAAC
ATCCATGAGCAGCCACCCTGCACCTCTTCACCAACCTGAGAACTTTGGATCAGAGGAACC
CAGGTGCCCAGCCCAGTCCTCTGCACTGTGGGGTGGGCAGCCAGTGCAGGAAACACCCAG
GACTCGGTAACCTCCTTATCAAAGGAGGAACACAGGAAAATGTCAAGATGCAGGAGCACG
GTGCAAACTCAGACTTCTGGCCCACCCAGAACGAGTCCAGAAGACAAAGACACAGAAGAA
ATTAGAAGCCACACACCTGAAATCTCTGAAGTGCTGGCAACTGAAGTAAAGAAATGACTT
AGTGCTTATATTGTTTAATTAATTTTGCAGGCCCAGGAGACATAGAGAAAGTTAGAAGCC
AGGTGCCTGAAATTTCTGAGATATTGGTAAATGAAGTAAAAAAACAACTTAGTGCTTGTG
CTGAAAAAGAAAAAAGAAAGAAAGGAATTCAATTCCAGTTTAGAGAATTTTAAAGGGTTA
ATCTAGGAGAGATACTGTCAGAGCTGAGAGGCTTGGAGGTTGCCTGAGATATAGCCGTGT
AAAAAGGAAGAGTGCATTTTAAAGGCAAGCAAAAATCACCAAGAAACAAAAGAGGATAGA
TTCAGGGTATGAAGGCAGTGTTCTGTGAGTGAAGACTGGATGGCTGTGGGGTAAAGAGAA
ATTGAGAGGCCGAGTGCCCAGTACATGAGGAAGGGTCCATCACAGGGGAAAGTCACGGGA
TTTTAGGTAGGGAGCACGGAGATCAAGTTATCCACATGAGTCCATGGTTGTGGCAAATTA
GATGGAGAAGAGAGAATTCAAAATGCCATTAGGAACAGGTTTGGTGGCACACATCTCTAA
TCCCAGCATTCTGGGAGGTTGAGGCAGAGGATCTCAAATTCAAATCTACCCTGGAGCAAT
TTAGTGATTTTTAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved