Cavia_porcellus Locus Mono:737:SNORA12
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:737:SNORA12
Cavia_porcellus
Mono:737:SNORA12
GeneScaffold_358
SNORA12
1001..1146
2146
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCT
TAAAGCAACTGTCCCACTTTTAAAGACGCATAACTTCGGTTATGAAGAGACTCACACATT
AGTTTCCAAACTAGAAGCTTGCTTGCAAATTGATAGTCTAGACTCAGTGAATGTTTACAC
TGCAAAGAGTAACTCTCAGAAATTAAAGTCATGCATGGGAAAGTTCAGCTCCTAAACCAA
AAACCTACTTCTGATGCCTATTCTTGAGATTCTGAAAGAGGACCAAGTGGAAAGGGTAGC
TTTAAAACAGCTGGGCATGATGGGTACATGCCTATAATCCCAGCACTCAGGAGGCTGAGG
CAGGAGGGTGGCTGTGAGTTTCAGGCCATTTGGGGCTCTGTAGTGGGTTCAAGGAGAGCC
TCATCTGCATAGAGATATCTTGCCTCAATAAGTAAATAAGTAGTTGTGATAGTCTCTTTC
TGACACATTTGTTAAGTTTTCAAATGGGTCTGACTCTACCACATACATAATAAGGAGCTA
TCAAAAGCTTAAAGACGAAAATATCTCTCTTGAGCTTTTATTGTATCAGATATTGGCTCT
CACAATCTATCTCATAAGTTTAAGTCCTGGAGCACTGGGAAAGCAAGCAACCCCTCTGGT
GAGCGGCTGTGAGCATGGCAGGATACGGCAGCCCAGGACAGGAGCCACCGGTGATTACTG
GGACCCGTGCCATGCTGGGACCTGGAGCACAGGGAAACCAAGCAACCCCCACCCCGACCC
CATGAGCGGCTGTGAGCCTGCCGGCCCAAGGGCTGAGAATCAAACATCACATCTTCTCCT
CCCCCCTCCCCTATTAGCAAGTGGGAGCCCGTGATCTGGAACCCTTTGAGCGGCTGACCA
TAGGCAATGTAGCAGATGGGGGACTTCCTTCTACCATCTCTTTGAAGGCAAATACTTTTA
TCCCTGGTTTGCTTTGTTCTCATTAATGGTGTTATTTTAGCCTGTTTTGTTTTGTTGAAC
TTCAATATACATGAAAGCATGGACAGCTATTTTGAAGAGAACAAGACACTCTACGACAGC
CATTGGTGACTTCCCTGTTGTCTGGTTTTGAAGACCTAAAATGCCCTCCTCATTCAGTTT
GGATCAGTTTTATACTATGTTGTTTTGTATGAATTCTCTGTACGCAAAGACATGGACAAC
TATTTGGAAGAGAACAAGAGACAATATGATAGATAGTGAAGATCTCAGGTTGTCTAGCTT
TGAAATTTATATCTCTTACATTGCTTTCTTATGTCTTAAAAAAAATAAGTATTCACCCTA
AATTCCCTACCTGGCCCCACTTTGCTTTCCTCTGACATCTAACTCTCCTATACTCTACCT
GGGTACAAAACGGGAATTGAAAACTCACACATTTAACCAGGGCACACAGGTAATTCAGTA
AGCGTGGCTCTTTAGGAATTTCCACAGGTGGAATTTACTTTCAGTGCTGTGTCATACGCC
TGGTCTCAGGATCAGGGGGGCCAGGGAGCAGTGTGGACTCTGGGAAACAGCAGGGCATGC
ACACCCCAAGGACTGGCTGCTCTCTCTCCAGCCTGCGGTGAGGCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved