Cavia_porcellus Locus Mono:16:SNORD35
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:16:SNORD35
Cavia_porcellus
Mono:16:SNORD35
scaffold_213334
SNORD35
1001..1087
2087
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCCCAGGTTACAG
AGGGCTCTTCGTCGCACAGGGAAAATAGCCTCTTAAAGACTGGCAGATTGATGGCTTTTT
CTCACGATGGTCTGCGGATGTCACTGCGCAGTGCAGATATCGCCAAAGGTTCAGCTAGAT
GTCAGAATGGGGTAGCTGGACACAGCGTGTGTATGGTCTCTCAAAGTTATGCAGTCAGAC
ACCCTCACAGATAGGACTCCTGCCTGTGGCACAGGAGGTTCTGGTTCCTCCATTTGGGGG
CAAGGGGTGGAGACAGCCCAGGACTTTAAACTGAGGCAGCTCCTGCTGCATGTGAGCACT
GTGGACTGGGGCAAGCATCATCGCCTTTCCTGAGCATGCTCAGTTTCTTTCCCTCTGCAG
TTTGCCTACTTGGGTCGCCTGGCCCATGAGGTTGGCTGGAAGTACCAGGCGGTGACAGCT
ACCCTGGAGGAGAAGAGGAAGGAGAAGGCCAAGATCCACTACCGGAAGAAGAAGCAAATC
ATGGTAAGGCTGGTGCTTCTCAAGGCTGTACTGTCCAGCTGATGGTTTGCAGCCCAGGGC
AGCCACTAACTACCTGCTGTCCTTGTCCCAACAGAGGCTACGGAAACAGGCTGAAAAGAA
TGTGGAGAAGAAAATTGGCAAGTTCACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTG
AACTAATAAAGACTGTTTTCTGCCTCACGCTTGGCCTGGCTTGCCCTTCCTCCATCGCCG
CCCTGGGATGTGGGGGACTCGGGGAGCTTGGGTAAAAGGCACTCTAATCTATGCCCCTTC
AGGGGCCTCCCATGAGTATACTTTAGCAGCTTTAAGTCTTGTATGTATGGATGGTGTTTC
TAACCTGCTCCTTCCTTCAGGAGCGCCTTAGAAAAGTGACAGTCCCCTTTTAGTCAGTAC
AGGGCAGCTCTGTCTCTGTGGCTGGATGCCATACTCTGCAGCTGTCGGAGAGGCACCTGA
CATGCCACCAGGTCTGCAGGTGCCCAGCTAAGGGATTGCAGCTGTGGTCTTTGCCCCCTT
CCCTCTTTGTCACCAGAAACAAATAAATTATTTTTAAGGAAACATGGTGTCCTTGCATGT
GTGCTATGCAGGCAGATACGTGGAACACAGGCCCTTCACAAGGAAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved