Cavia_porcellus Locus Mono:265:SNORA73
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:265:SNORA73
Cavia_porcellus
Mono:265:SNORA73
scaffold_174311
SNORA73
1001..1197
2197
GGGGATCTATCAGATTAGCTTGGTTGCAACTCACGTATCTGAGATCAAGCAAAGAGCAG
AAATCAATGGGGCGGGGGGAAGCTGACAGACATGTAACCTCTAGAAAGCAGTTGCCCCAT
CTGAAGGAGGCTGCTTCTGGCATGTCGAGGGTTGGGGTAGAAGGGAGTTTTCACTTTATA
TCCTTTAGTACTTTTTCAGTTTTGGGGGAGGTGCTGGGACTCTAGGACCTTGTGTTTCAC
AGGCAGGTGCTTATGCCACCGGGCTATATCCCCAGCTACTTTTTCAATTTTATTCATAAT
GTCTTACCTAGTCTGAAAAACAAAACAAAAAAAAGGCTCATAAAATAAAGTAACCATTAT
TCAACCCCAATTTTACTCTTTCCTTCAGGGAATATAGGCCCTTTGAGGCCATATATTTTG
ATACTTAAAGAGAAAACTTTAAAATTTGCATACTACAAAAATGAAGCATGATTCTTTGGA
GGAAAAGGAGGGATTTTTTAAGTATCTCTGTAATCAGCTATTGTAAATATGTTGCTTGGA
CCAGTAGCATCAGACTCATCTAGCAGTGCATTAAAAATGCAAACTTAAGCTGAGCACAAG
GGCACTTGCCTACAGTCCCAGCACTTGGGAGGCTGAGGCAGGAGGATCTCAGTGAGTTTG
AGGCCAGCCTGATCTACATAGCAAGGTCTTGTCTTAAGAAACAAAAACAAAAAAAGAAAT
GCAAACTCTTGAGCCCACAGGAACCTGCTGAATTGAACTCTGGTGTGAGCTTGGCAATCT
TCTTCAATAAATCCCCTCTGTCCCCTAAACTCTTGCCTCACCTTGACTTGTGAACCGCAT
GTAAAAAGTACAGCTGGGTTATGAACAGCTGGCTGCACAATGGAAAGTGTGTTAAATGAA
CACTGTTCATTTGTAGATTGTAGATATTGACAGAGAAGTTGTGAAAACCAGTGAAACCTA
GAAGCCTTACTGCAGCAATTTGATACACTAGCAAAAAGATGTGGATACTCTGGAAGGTAA
CTCTCCCCTGGCTCTGTCCAGGTGGCACAGGGAAGCATAGCGCTTTGCCCTGTGATGTAC
AATTCCTTTCCACAAGGCTGGGGAAGAACTGGGCCTTGTGTCTGCGCCAGCATATTCCTA
CAGCTTCTCAGAGTCCTTTGGGCAATGACTGAGTGGATAAATCATGCAGGAAACAATGTC
TAGTCAAGACTTTAAATATGAACTACAAACTTCAAGAATATAGTTTTGTGGCCAGGGATT
TAGCTTAGCGGCTCAAGTGCTTGCGTCATGAGTTCGATCCTGGTTTAAAAAAAAGAAAAA
ATCTTGTGGGTTTTTTTTTTTTCCTTTCAATAAAATTAAATTTTAAAAAAAGTTTGAATA
AAGGGGGAGGAAACGATCTGGGGACCTGGGGTTTGCCTTGCTTTAAAATTTGTCCTCTTA
AATTATAAAGAATAGAGCAGAAATTAATACATTGAAGACTACAAAAAAATACAGAGAATG
AAAGACTTGCTTCTTTGAAAGACTGAATAAAATTGACAAACCCTTAGTCAACCATATCAA
AAAAAAGAAAAGACTCAAATCCACACCATTAGGAATGAAAAAGATGAAATCACAACAGAC
CCAGATTTTTCTGTAGAAATCTAGAACATTATCTATACCTACTTTGAAAACTTATATTTA
ATAAAATGGGAAGTATAGAAGAAATGGACATATTCCTACATACATATAAATTACCAAAGC
TGAATCAAGAAGCTATAAAAGTAAGTAACCCAATATCAATAAATGAAATCAAAGATATAA
GTAAAAAACTATCAACAAAAAATCCCAGACCCTAATGGATTCACTGCTAAGTTCTACAAG
AAATTTAGTGAAGACCTAACACCACTACTTCTCAAACTTTTTAATGAAATTGAAAGTGAA
GCAATCCTAAATTTATTCTGGAAGCATGCATTACCCTAACACCAAAACTGGAGAAGGACC
CAACTAACAAAGAGAATTATAGGGCAATCTCCCTAATGAACCCTGATGCAAAAATCCACA
GTTAGATACTGACAGACAGACTGCAGCAAATTATCAAAAAGATTGTACATCATGATCAAG
TAAGATTCATCCCAGGGATGCAAGGATGGTTCAACGTACATAAATCCATAAATACAATAC
ACCATATTAACAGAGCTAAGGACAAAAATCATATGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved