Cavia_porcellus Locus Mono:365:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:365:SNORA2
Cavia_porcellus
Mono:365:SNORA2
scaffold_216380
SNORA2
1001..1137
1518
ATATGACTACAACAAGGAATTAGCACGGCAAAGTAGTTTATTCTCTCGCACTCAAAAAT
AATTTTTAGTAGTGGGAAACATTCATATAAAGAAGTCCAAATCAAAGGTCAAGTAAGAAA
AGTCATGATGTAGGGGCTGGGGATTTAGCTTAGCGGCATAAGTGCCTGCCTTGGAAGCAG
GCAGTCGTGAGTTTGATCCTGGTACCGATAAAAAGACAAAAAAAAAGACAAGTCATGATG
TTGAAAGGACTTAACAAAATAAAAACACCTACTGTTTCATATTAAAAATAGAATTAGTGA
CAGTCCAATGAATTCCAAAAAGGAAGTGATGCGTTTACCTGGATTTCCACTTTAGAAATG
GAACATTTTAAAGAAATTTTCTCTGGCCCTGAATCAAGGTCGGCAGCTTCCTGACACTGT
TGGTTTCAAGCAAGAGCCTAAAGAGATGTCTTTCTATGGTCTGTTGGCCATTTCAGAACT
TGGGCAGTGAAATGATCAATTCATTAGAAAGAAACAGCTTGAAGTACCACCCCACCCCAC
CCCCAGCCCTGGCCATGACCAGCTGTGAGCATGGCAGGTTGTGGCGGCCCAGGACGGGAG
CCACTGGCATTTACTGGGACCTGAGCCATGCTGGAACTTGGAGTGCTGGGAAACCAAGCA
ACCCCTCCACCCCCTGCCCATTTTGTTTTGTTGAATTTCAATATACATGAAAGTATGAAC
AGCTATTTTGAAGAGAACAAGAGACTCTATGACAGCCATTAGTGACTTTCCTATTGTCTG
GTTTTCAAGACCTAAAACGCCTTTCTCATTCTGTTCAGATCAGTTTTATACTTTGCTGTT
TTGTATGAATTCTGTGTAATGCAAAGACATGGACAACTATTTGGAAGAAAACGAGACAAT
ATGATAGACAGTGAAGATCTCAGGTCGTCTAGCTTTGAAATTTATATCTCTTACACTGCT
TTATGTCCTATTTTGTTCCATTTCGTTGTGTTTAATTTTACCCCCTTTAAATAAAAATTA
AAAAAGAAAAATAAAAATAAAAATAAAAAATTTTTTTGGTATCAGGGATTGAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved