Cavia_porcellus Locus Poly:12:SNORD113
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:12:SNORD113
Cavia_porcellus
Poly:12:SNORD113
scaffold_254775
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 3251..3325, 5397..5469, 7337..7408, 12208..12274
13274
TTCACGGAGCCTTTTAGTATGTGTGGTTGAGACAATTTTTCGTAGTTTGCTGTTCATTT
TTTTTTAATTAAGAAAAGGAAAATGAGTGCGCCAGCCAATAACCAGCTTCTTAACAGACT
TCATCTTGGCAGCCGTGTGTGACTGCTGTAGGTGTTACTCTTGGACAGATGATGCCGTCA
GGACTGTTTATCATAGCGTTTGAAACTGAAGGTTCAATACTAGACGCATACGACTTGCGT
TGTGGAGCCAAAGTTTGTGTCTTATTTTGCTTGACTAACTCATTACAAGATCTGAGTCCA
TCTCTTTTTTTTCCCCTCCCTAGGGAGAACCCAGGACTGCTGGCTTAATCATTTAATAAA
GAATAGTTAGCCAGAATCAGGAGCATAGATACAGTCCAGGCAAGTCCTTGGTTCGTGATC
TTCATTTGGTGGCTTGGTGGTGGTGCTGGCTACAGGGTTACTGCCGGTACTACTGCGGGG
AAAAAATGAGCCCAGCACCTCAGACAGGGACCAGTAATGGAGTGTGTCACCAGCCACAAA
TTATGTTTAAATTAACATAACTATTATTATCTTAGAAGGTGATAAGAGTTATTAAATTGT
TATCGGGATGTTTTATTTTTTTTTAATACCGTAGTTGATTTCAGTTTCCTCTCTGGGCAG
AAATGCTGGCTGACAACTCTGTTGGGATAGTCAGGAATATAGGTGACCTTTGTGAGGGTT
TCAGCGGTAACAAGGTGGCAGCCTCATTGTTCTTCTTTGACCATCTTAGGCTAGAATGAA
TTGAGGAGGGCACACAAAATTCAGTGGTGAATGGAGATTTGATAGAAAGTTGGAGATTTG
ATAGAAACTGATTAGCTGATACGTGCACCTTTGAGCATCACTGTAAAAAATAATGTGATA
AGAACCTAGCATGCAAAGGCTTTTGGGGGCCTGGCAGGTTATGATTGTATGTTTTTTGTA
AGTTGGTAAATTAGTCAATGCGTGAAAAAAAATGACTAGTGTGGACCGATGATGAATTGC
ATGGGGTTTCTGAAACCAGGACTCTGATTAAGCCCATCTGCAACTCTGAGGTCCGTGGTG
AAGAGTTTCTTGATGGAAGAGGAGTCTACCGAACCTCGTTCTTGTTCCTTGTAGTTTGGG
TGGGGGGGCTGAATTACCGCAGTGTAAGCAAACTAGCCACGAATGGCAAATGTATTAGTA
AAAGAATACTAGGATGTGTGGGTATCTGCTGCTCATTACTAACTCTGAGACTGTTAGTTC
CAGGCAGTGAACAGTGAAGGTCTTAGCACTCAGACAATCATCGGTACCTGAGACTCAGGG
ATTCTACTCTATGTTGAGGCAGGCTTTCTGCTATTTTTTAAGTCAAAGGAAATTCATTTA
CATAAATAAGTATTTGATTAATAAACACCTATATGAGAGAGGGGCATAGAATCAATGAGA
ACTTATACATCCAACTTCATGATTAATGCAGTCTTTGTATTTCATTTTAAGAAAGAAAAG
AAACATTAAATTGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCTGTAAGCTGTTAGAAAAGTAATCCCTTGTGATCCCAGTAAATGTCTCAGTTAATG
GGTGATTTAATAAATATAGTGAGGTGCTAAGCTTGAGCCATGGGTGGACTGTGCCATATA
TTGAGCCTCTGCTGTATCCACTTTTGTCCAATATCACCACAGGGTGATATATATATATAT
ATATATTTTTTTTGTCTTTTTCATTTTTACCAGTACCAGGGATTGAACTCACGACTGCCT
GCTTGTAAGGCAGGCCCTTATGCTGTGGAGCTAAATCCCCAGCCCCAACAGGGTGATATT
TTGGTCTTACCTAATATACATGAAAGGTCCAGACAAATGTCCCTAATTATTATAGTAAAT
TTCTTTGTTTTTCACAAGTAAATTCAGTAGTGTGTATTTATTCATTTAAAACAATGAATT
ACGGAAATTAATAGGTATATTGTTCTCTCTTTCAAATTATATAACTCAATCAATATAAAA
TAATGTCCTCTTCCCAAGTGTTCAAAATAGATTACAAGCCAAACTTTGTGGTTCATCAGT
TGCTTCCTAACTGTGGTTCATTTAAAACAACTAAATTATACCATTTGGGTTTATTTAAAC
GTGGACTTTTTGCTCTGCAGAGTGAACACAGTCTGCTTGGTTTCATCATTGTCTTCGGGT
TAAGATCTTGTCTTTGAAGGACAGAGGATACCAATATAAGTAAGAATAAAAGCGTGTGTC
ATTTCTCTGATAGAGCTTTGATCATAATATTCATGGAATTATTTTAAACGATTAAGTTCA
AAAGTTGTGACACATTGACCCAGTGATAGAAATTTTTCATGAATTAATAATTATGATTCA
TTCCCATCAACACAGCTGAATTACCTGGCACGGAAAGATGAATGGTGTGTCTGCCATTCT
GAGCATTTTTAACAGGGTATTTTATTTCTGTGCCACAGTGAATGCAAACACTTCTCCCTT
GTTATTGTAACAGACTGGTAACCCGTTGAGAGGAGGAGATAAAAAAACGCAGTCTTGCTT
CTCCTTGGCTGTGATGTGAGATAGTAGTTCATTGCACCATCTTTAAAACATGGGTGTTAA
ATGAAAGAGGTCCAAGGATCCCTCTCTCTCTCCCTCTCTCTTTCTCTCCCTTTGTCTCTC
TCTCTGTCTTTCTCTCCCTCTGTCCGTTTCTCTCTCTCTCCCTTTTCCTGTATCTTTTTC
TCTCTCTCCCTTTCTCTCTGTCTCTCTCTTTCTCTCTTTTTCTCTCTCTTTGTTCTTGAA
ATGAAAATGAGAACCTTGCACTTGCCAGGCAAGGCACCATGCCACTGAGCTATATCCACA
ATTCCCTGGCACCCAAGGATGGACCAGTGACCAATAGCAAAGTGACTTGGTACAAGGAAG
TGGTCCATCCCTGTTTGCAACACTGAAGTCTGCTACCGAGAGATTTGGGCTCTGGTGTGT
GGGACGTGACCTTCCACAGACACACCCATATTAAGGACCTGTTCCCCCAAAATTCATACA
CAGTGTTTATATTATCAGAGAATCCCCAAATCCAAATAATACGACCAAATGAAAGCACAG
ACTACCAAGTCTGGATCAATGATGAGTATGCGTGGGGCATCTGAACCAAGTCCTCTGATT
AAACTGTCTGTAACTCTGAGGTCTTTTCTGTGTATGGGAAATGTGCTTACAGAGGAACTG
GACATTTTCAGGAAATGCGTTTAGGGTTTTTAGTTGTGCATTTAGACAGCCTGTCTTATT
TTTAAAAAATTCACACACAAGTCAAGCTGGGCCACACACATTGAGCGGGAAAGGGACTGA
CATTTCAGGGACTGATGTCCGTCTCTGAAGTTTGGAGTTTGGGAACACAGTCTCGGCTGC
TCTCCCTGGGCAGGAACTGGACCTACTACTCTCTGTTGTGTTATTTTGGGTCAGGGTGAG
TTGCTCAGTGCATGTCTCTGGTTAAAAAGTGATGCAGAATTTATTTAATTAAGTTATACA
TTAGCACAATAGTATTTAATAAATAGAACCTAAAATACACACATTAACTAATCTGATGTG
ACTAATTATGCTAGCTGCATTAATATAAAATGTTTTAATTATCAACTTAATGTAATTAAC
AAAGACTGAAAGGCTAATGACTAGTTAATGAAACATGAAAAAGTCTAAATGTGAACATTA
AGGTGTGACTATCATCATACATGCTTCTGTAGTCAGTGACTTTTGTTAAAAATGGAAAAT
GTCAGTACGTTCGGGATAATTTTTGTGTGTAGTGGGAAGAAGTTCACATCACCCACGATT
CGGTCCATCGACCTTAAGGGTGATGGATGCGGTGCTATCTTCATGAGGAAATAAAAGAAT
AATTCCGTATCTCTGCCCATTAGTTAAAAGGGGGAACTGTGGACCCGTGTGGGGGCATAC
ACTATCTGAAGTGGTGTCATTGATCCTGCTCTTACAGGTTAATCTTTACTCTTAAAGGTT
ATTTCAACAGATGAGGTCCACCGATGGACTTCACCCTCCCCATAGATCTTGCTGTTAACG
TTTAAATTCAAACGAACATAGAATAAAAATTTAGCTCCTTAGTCACCCTTCAGCACATTC
CAAGCAGCCATTTGTGTCACCGAGGAAGTCCTGTGGCGCAGTTTCCTGTAGACAGTCGCG
GTGCGGGGCGTGTGTTTTGGGTAGCAGATGGTGCTGCTGTTTTGTGTTTTCTTTAGGGAA
AAACAGTAGATTATTAAATTATCCTGAGAGTCAGTAAACAAGTGAATCAGTACATCCATG
AAATACAGTACAAGACGGCTCATCGGTGGCCCAAAACACAAATTGAAATTTGTGCCATTT
GGGAAAAGTTTCCCAGTTTAACCATTCCCTGTCCTTGGTGCTGTTGGATAGAGGTGTCTA
GGCAGAACATCATCTTCATTGGTTTTCTGTTGAGTGATATATCTAAAGATTTTAACCGTG
TTATTTCATACGAAAAATGGAGTGAGGCAGAGCTTGCAAATGATGTCACAGATGGATTGA
GGAGGAAAGTGTGACACACCGATCAGTGTTTGTGATTCACTTAGTGGTACAGCTCTCACC
TCGACTCAATAGTCTATTGACATTTTAATGTTTGCATTTTTATTTTGCAATCTGTCTTTT
CCTCCATAATGAGCGCCCCGCACTGGATTTGCTCTTTCTCATCTGACGAAAATCTTGGCT
GTTACTGTCACAGGTAAGAAGCTGTGTGAATAACAATCAGAATTTCTATTATTGGTTTCT
CTATATATAGTCACGGAAGCAGGAACCCAAGACACAAAAATTAAACTCAACAGTGCCCAC
CATGGACCTATAGAGAAGTGGGGGGAACCCATTCCAGAACCGAGATTCCTTTTTTAAAAA
GATCATCCACATTAGGATAATTTCCACAACTCTTTTTTGGTATTCCATATTATTTTTGCA
GCATGCTTGAGTTAAGCATTTCCATACTGTTAACAATGTGGGCCTTTAACACATTAGAAA
AATCTCTTAGACGGTGACCCATGTTGCTTTGGTTCTGGTTTTGGGGTGCCACCTTGGGTT
TTGATTGCTAATGACAGCATCCTTAGAATACAGGCTGAGTCCGTGGACACGGCTGTTGTG
GAGCACGGATATCGACAGACTGACAGTAAATGAGATTCAGGGCCCTGTCCCATCCGAGCA
CTTCATATTCGGATTCAGGACCAAGCCGAAGTGGGGGGGAGACACTAGCGCCGAGCCTGG
ACCAATGATGAGATTGGAGGGTGTCTGAATCAAATATTTGATTAAAGCCATCTTGAACTC
TGAGGTCCATTTCCAAAAGTGGCCTCTCTTTGTCCTCTGTGGAGTTTATAAAAATCTCTG
GAATTCAGCATAGCTAGATGGTGGAGCATGGATTATTCCAATACACTATTTCTGTACTGC
TGGGTCCCAGTGACAAATAGTGGTAAAGACATCGCCACTTTGCATAGTGAGTGGCGTGCA
GACAGAAGTCTCAGTGCCATCGTTTGATGTAGGTGGGTGTTTGCTGGGTGTTTGTACTTA
GAGGGAGGAAAATTAAAAAACAAACAACAGATTCAGCAGTTATTTAGTTGGCAGAAAGAA
TGAGAAGAGCTCATCTTGAGAGTATCCCTAGGGAAGGAGTTATTAATCCAAACATGAGTT
TTATTAAAAATGTGAAGGAACATCTGTTTTAAAATTTATGTTCTTGATTCACTTATATTA
ATTATACATATTAATGGGGTGCAGTATTGTATTTAAACAAATGCATCTGGATTTTGAATC
TCCACGGGCAACGGGAGGAACATATGGAGACATAACAGCATTATTCCCGGTTTTGGATTA
ACACTAGTTATTTCTTATGTTGATGAATGATTGCTTTGGAATACAATAGGTCCTTATCAT
GGTTATGTTTTTAAAAGCAGGCAGAGCCCAGAAGGAGTGAGATAGGGCTGGGGAAGCGAC
TTAGTGGTAGGTCACTTGCCTAGCGTGCAGGAGGTCCTGGGTTCAATTCCCACTACCCCA
AAATCAAACAAAAAAGAAAAACAAGAAAAGCATAAAAGTAATGCCATCTTCCTAGTTTGA
ATATGAGAATAGGCAATCAACCATGCATGTAATCTCACCTGTTTCTTCACAAATTGACTC
CACAAAAAACAGGATTATAGATGCCCTTGCCTCCTGGATAAGGAATCTGTAGTGTGCAAC
CCTGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTT
CTGATTTTTGCACAGGTTTACGTTAATATATATCCCGTAATAAAATCTAGGGCTGCCCTG
TCCAACTGGCTGCTTCCTCCACCTGGGGCTATTTGCCTTTAAGGTAATTCTGTAGAAATG
AGTTTTTGGCTTAGGTTTCTTGGCTGCACCGGCCCTGTTTCGAGCAGGGAGGGAGATGCA
TGTGGTCTGGGCACTGTCTGGGAGAGTGCAGTTCACAGCACCATTGCGCCTCACACCCAG
GGCTCTCTATTAGGCAGCTCCTGATGAGGAGCAGGTGGGAGAGAAGCGCTGGAGGAGGCC
GAACCCTTCCACCACAAAGGTGTTAATTGGCCCTTCTGTGCTGTGCGGGAGGTCTGTTAC
AGGAGAGGGGTGCGCTGTTGGGAACATCTTGTCGGTGGGAAAACAGCCTTGCACACATAT
CTTGGTTGTGTTTGGGGCTGTTGTTCTGGCTTGTTTTTTTTTAAAAAAATTCATTAGTAT
TAATTTTATTATTGCTAGAAAAGCACCAAATGGATTAATACAAAAAAGTACAAATGAAGG
AAAAAGGCTGCTCACTCTGGATCAATGATGAGTACCCTGGGGTGTCTGAATCAAGGACTT
TGATTAAACCCTATAACTCTGAGATCCATCACAGGAAGATTTGCATTTATGATTTTATGG
GAAATAGGCATATTTCAGGAGCTTAAGACAATATGGATTGTGTTATTAGACTTCTGGGTA
TAGATTATTATTTTTTTTTCCTGTGAAACAGTTCATAAATCAAGAAAAATATAAATGACT
TAAGACAAAATGGGTTATTTCTGGTATCAATATGAAAGTACTTACTGCAGGAAGAGCCAT
GACTAATGATACATTTATGAAGCACTGAATTTCAGTGACATAAATTGATCAAAGTGGGCT
CTTTTGGGTAAGGAACATTTACATAACTAGATGTTAGCATCTCTGTTGTTGTACTAGGTC
AGGTTCCTTGTCTGATTAAGAAAAGGACAAAATACTTATATTAGGTGTTTATTAAATAGC
TACTAGTTGAGAGGTCGTAGATATGGATCTATGTTAAGACTATATCATATAACTAATTGT
GATTAAACCAGTAACTCTTACTATGTTTAAATTGAAGTTTTGTTAAAAATGTGAACTGAT
GGTTTCTCTGTGTCTAAAGACTATTCAGGTACACATTAATATCGTACAGTTTCTGTGAAA
TTACAGGTATAATATTATATGGCTGTGATGCACAAAGAAGTGAACACTGCGGCCCACTAT
TTAATTACTCGGGTATTAAGAATAGTCAGCATCTTATCCCTGATCTTTGTGTTCATGATT
TTCTACTCTTTATTTACAGTAAGATCCATGCATGGATCATTATATAAATATGTAAATAAA
GATAAATCATGTGACACATTGACTAGTTGTGAAAATAAATGGATGACAGGCAATGTTAAT
ATATATGGAAAATTCTGAACTCTGTTCAGAAATGATTTAGAAGTGTTAGAGTTTGAACTG
TTGTGTGACTAGAACAGACAATAGATAGTGTTAGGGTCAGAGCCATGTTCTGTGGTTTTT
TTGTTTTGCTTAAAAAATATACATCACAATTTGGCTCCTTTTTAAATGACTAATTTAAGA
CAAGGAAGGGCTCCAGGGTAAGTGGACAAATACTATTTTTTAAAATACCCTGTTCTTCTT
TGTACTCTCAGCACGGCTGTGTCCGACCTGAGGGGAGCACTTTCCTGCCGATGACACCCA
TGGTCCCCAGGGAGACCCAAGTGAGTGCGGGGGCTCGGGTGGATGTGAAACCATGTTCAT
TGTGTTGGTGGAAGCCTCACGTGTACCCCAAGGATGGCGACTTGGTCACAGGAGAAATAG
AAAATGGCCATGACGTGCTCTGTAATTTAATCAGTAATTGTGAAATTAAGATTGGCTAAG
AAGAGACCTATTTACTGTGGCAAAAGATCCTGCAGTCAGCTCACGGTGCACCAAGGGATC
TTGTTCTTAATTGTTTTATGATTCCTAGTGATGCCTAATTAATATTAGTGAAGTAAACAG
TGCATGACCCAATGGAGAAAGTAATGGAAAGGCGAAGGAGTTAGCACAACAGTGCAGGGC
CTGCCTGGCAAACTCGAGGTTCTGAGTTTGCGTCTTGGTACCAAAAATAAGTAAGTAACT
TAGTGGATAAAGATGGCCAGGCTTGGATCAGTTATGGCCACTGGTGGGGAGTGAGGCAGG
GATGGTGACCACCGCTGTACAGGCTGAGTCCCAGCACAGGAAGCCCTCCAGCATGTACTT
TAGACCGTACGACTACAGCCTGGGTGTAGTCAAGGTGGTTCTCAGTCATCAAGGCTCACT
CTGTGTTTCTAATTGGATCAATGAAAGTGTCATTGAACAAATACACAAATAATGAAGTGT
CTGAAGCATTGACCAGTGATGAACAATAATGTGCCAAGAAATTCAACTCTTGTGAACAAA
AACCCTCACTACAATATTGCAGCCTTGGTAGTGCATGCCATATTTAGTAAGTGTAATGCC
TTTAAGTCCTTCTTTTGTCCAGTGTTACGTGTTTCCTTAGGAAGAATATGTGATCACATT
GCCTCTTGTACTTAATGACTAGTGAAATGTAAGGCAGGATGAAGGGAAAAGAGAAAAAAC
TTAAATCTGTACATTTTCTGCTTTGGGGTTGGGGACAGCTCGGAGGCCCAGTGTCTCCAT
GACAGCACAAGGCCAGGAGTTCGATTTCTGGTAATCCCCCTCAAAAAAAAAAAATCACTG
TTTTCTGTTTTGTACTCCCAGGATGCATGCTCTACACTGACACCAGCCTCTTTCTGAGAG
CATGAAGGTCATGGTTGACTCCTTGTTCTAGGCGCTTGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTAAGGGTTTAGTCCTAGGTGTACTC
CTTCATGTGGCAAAACTTCTGTAAGGTAGCTTGAGAAGTATAGGTCAAAGGCTTCCTCCC
TATCGGCATATGATTGATAGTTATCTAAATATCATCAATAAGATGATAAGTTAAGGAACA
AGGAGATTTTATAAAATCAATGCAGAGAAAGAGGACCTTGGGTCGATGATGAGCCCTTTG
TGGTGTGCGAGGCAGGGCTGGGTCAATGTAGCTCTGGAAGTCTGAGGTCTAACGCTAAGG
GTGTCTCCCTGTGCACCTCCTGAGCCTAGGGATGGGTGTTTGCAGGAGTCGGGAGTGTTA
CTCTTGTTCATTGTGTTCTTGGTCATTGCACTGAGGAAATTTCAATGTTTTTTTCTTACA
TTCAAAAAACCCTTTATTATAAAAAGAACAAAGCCAAATAATAAATCAGAATAAACTAAT
CAAAACAGAGTAGCGAAAATTATACAGGACTTAAAAACAGGATCATAAGGCATCAACAAC
AGTAACATAAGATATCTTGTGATTTTCATAATGGTCCACTCCATCAGACATAATAAAATC
AAACAAAATAAAACAGTGTAAGACCAAACAAAACAAAACAATGAAAACAATACAGGACTT
CAAAACAAAATAATAGGAAATTAACAATGGTACCATAATGCCCTTTATTGTTTTCAAAAT
AGCCATCTAGACAATCAGCTATAGATATGTAAAATTAACCAAGATGTTTCCATTTATTTT
TGTAACTGACTTAATGGCAGAACCATTACACAAATATATAAATAAAGATAAAGGAGTGGT
GTTTGCCAGCTTTGAAAATAAATTGGTGAGTAGAACTATTATTAATATATTTAAACACAC
CAAAGACCACTTATAAATAAATCGTTCAAAGGTATTCTATACAATAATGACCAGAGTGCA
TGGTACAGTCAAAGAGCCCAATGTTCAATGTTGTTTGTTTTCTCAAGAAAAAAAAATATA
GTCACAATTTGTTTCTTATTTGCATGACTAGTGAAAGGAAAGAGCAAATACACGAGTGGA
ACAGGTACAGGGATAAATGGGCAGGCGTCACTTTTTCTAATCGTCTGCTTTGTCCTCCAG
GATGGGTGCCGCCCTGCTCACCAAAGCATTTCCCGGCCAGGAGCTCTGTGGCTGCCTCTG
TATTGGGAGCGTGGAGACCGATGTGAGTGAAGACAATGCTCTTAGCTTGTGTTGGGCAGT
TTTTGAAAGAGGCTTACTGTCTGGGTGGAAGCATAAATGATCTAAGAATGTCAGCCATGC
TTCACTCACAAATAAGAAACGGTCCTGAAACACCGCTGTTTTGTATTTTGGTTGAAAGCC
TACTCAGTATGACAAAATGGCTTATAGTTAGCTCAAATTATACCCAAGGATAATATTCAT
TTTACATGCCTCTTCATGTTTGAGTTTCTAATGAAATTAATGGTCCATAATATCATGTAA
AACTAAGAAAACAAGGGAAAGCCAATTCTGGACCAGTAATGACCACTGGTGGCCATCATG
GCTGATGGTTATACCTCTGGAAGTCTGAGGTCCAACACTGTAAGACATCTTGTATGTAAC
TTGTCGTCCTGCGGGTAGGTGTTAAGGATACTTAAGGGGGTTCTTGGTCTTTCGGTTTAA
GAAGTTGCAATCTACTTTTCCAACTTTATTAATAGAAGCATTATACCAGATAGAGCATGA
GGTATTATATAATTATAAAGATACAAGATAGGATAGGATACCTGGAAGTATGTAATTTGT
ATATTTAAAATCACCTAAATCATTAAAAGACAAAAACCTCAAATGTGTAAACTATAAGGA
CTGTGTCCTTGTTAACACCATGTACTAAATGTTCAATGTTTTCTTTCTTCAAAAGTTATA
ATTTACTTCCTACTGAAATGATTAATGAAATGAAATTAGAGATGCAAGGATAAATGAACA
GAGACTGAATTTTTTATACTCTTTTCTGTTTGTACTCTCAGAATGGAAAGTCCCACCCTT
CTTCCCACCTTATGTGTTCTGTGTTACCCTGCGTATGTTTAAGACCATGGCTACCAATGT
GAGTACACAGATAGTGTGTTGGCTTGGGTTGTTTTGTTTTTTGGGGGCATGGTTTTTATA
TTGTGCTCACTGGGTTGGTAGAAGCATTACATATAACCCAAGAATGCTGTCTTAGTCACT
TTTCATACAGCTAGCACAATATACCCAATGGAGGAAAAGTTTATCTGAGATTTCAGTGCA
CTGTCAGCAGGTATCCCAAGGGGCACTGCAGAGGAGGAAGAGTTTATGGTAGTGCAGGAA
AGAGGCAACAAAGCAGCGAGAAGGGAAGGAAGCCTTCCTTTCCCTTTTCATCCCTTCCCA
GGCTGCAATCCTATTGGTTGATCCCTCCCACAGCCAGGGTGGGGCTTCCCATTATCCACA
CTCAGAACAGTGCTCACTGATCATTGGACAAATCCAATCATTATACCCTGAATCCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved