Cavia_porcellus Locus Mono:435:SNORA1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:435:SNORA1
Cavia_porcellus
Mono:435:SNORA1
scaffold_206223
SNORA1
1001..1129
2129
CAGGGATCAAACTCACGACTGCCTGCTTGCAGGGCAGGCGCTTATGCTGCTGAGCTAAA
TCTCCAGCCCCTAATTTCTAATTTAATTTCTAGCTTTATGTAGCAAATGCCTCAAGTTGT
ATCTTTAGGCAGATGCCTGCATCTCCAGGGTTGGGATGGAAGTTTGTACCATAAACTAAG
TTCTATGAAAAGTACATGAAGTCACTGATATTCAGTTGTCACTTTTTTTCTTATTGTAAG
AGCAGCAGCTATGATTTCCCACCTTTTTTACACATCAAACTTAAAGCTGGAAGATTTCTT
TGGACACAACCATTAAATATTTATGATAATATCAATATATTTATATATAAAATAAAATCA
CCTCACCTATCAATGTTGAATATGAATATACAGTTGTTGCAAGTTCTTTCAGACTGGTAT
TGGGCTTCATAATGTAGGAGGGTTCACATACTCAACCCTCAAATCTCTTTTCAGTCCACC
CTCACTATCTTGATGATCACATGTAGTCTTAGAATTTTTTTTTCCTTTGGGCTGATGGGT
CTCAAATTAAGCCTGGAACTCTTTCCCAAATTTAGAATTCTTTATCCAGCTGTCAATTCA
GATCACTCCATGGAGGTCTAATAGAAATCCCAGATTTATCTTCTCCCTCCACACCTATAC
AACTATAGCATCACAATAGCAGTTCATAGAAACTCCACCTTTCCAGTATCAAGCCAAAAG
TCTTGGTATATTATCCCTGAAACTTCTGGTTTCTTATATTTTCCTTTCAATCTGTCTATA
AATCATACTGACTCTACCTTAAAAATAATACTGAAATCTGATCACGTTGTCCCATTTTGA
CTGGGAACATCTGACCTAAGTCATTATCACCTCTCGTCTGGATAGGGCAAAAGCCCCATA
TTGGTGCTCCCTGCCTCTAAACATATTTCCCTTCTTCCTTTCCAACTTAAGTGTTTCTCA
ACATACTACTTAGAGTGATCCATTTAAAATATAAACTACAAAGCCTCGTCTAGGTTAGGG
CACTGTTGATTGGTGTCCAAAATTGGTCAGCGTGGCTAAAACTGAGACCCAGGTGTATGC
TTCCATCACAGTAAGTGTTTATAGTGGTGATAATGACACCTGTAACATTTTGACTAATAA
TGAAAAATACTGATTTTCAATTTTAGAAATAAATGGTTAGGGAAAAATACAGAATCTAGA
TAATGTGAAAAAATACCAAAGCTATGTACAATTCAAATACTACACTCCTAAAATGTACAT
TGCTGCAAGAAACTTGAATATAAGATCCTGGAGTTTGGAAGTTATCACTGTACATAATTC
AAGTGGAGATAAAAGAATTATGCCAAAGTAGATGGAATGAATGGAGTAGGAATCAATTAT
TTTTAAAAGGGCTATCTTGAAGATAAAGAACCTCACTCAAATGAACTTGACAAATATTTA
AAAAATCATGTGAAATTTCTAATCTTTAATTATAAAAAATTAAAGTTATAAATTATTTTT
CCAGTGTCATTTATTAAAAGTGACTGTTTTTGTTCCAGTGAATGTATTTGGCCTCTTTGT
AAAAGATAATGTGGCTGAATGTGTTTCATTTGAATTGCTTCTATAGCTTATAATCTGTCC
TATTGACACTCAGGGGTTGTTTCTGCTTTTGTTTTTATTTTTGGTTGTTTTGTCAGTACC
ATGCTGTTTTTGTCACAGTAACTCTATAGTATAATTTTAAGCCAGAGATTGTGATACCCC
CTTCCTTGAATTTGTTGCTCAGAATTGCTTTTGCTATTCTAGGTCTCTTTTCGTTCCAAA
CGAATTTGAAGACTATTTTCTCTAGTTCTGTGAGGCATGCTAAAGAGTATTTTGACTATG
ATCATTTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGACAT
TGTATTTGCTGTAGCTAATTCTGCTCTATATAATATGGGCCATGCGTTAATTATGCATCC
TGCCATCACTTACTCTTCCTCTCACTTCCTCCTCACCAACCATATCATCTTTCTTGGTGT
TCTTTGAAATTAGTTGTGTCCCCATTTAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved