Cavia_porcellus Locus Mono:684:SNORA64
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:684:SNORA64
Cavia_porcellus
Mono:684:SNORA64
GeneScaffold_2196
SNORA64
1001..1126
2126
CTTTGTAGAGCTGCAAATGTCAAAGAAATGAATTTCCAGAAAACATCAAGAGACTGACT
ACTCAGTAGATACTCCCCAGCAGTTATTCTAATAGCTGTACAAAAGCCCCCTAATCTGTT
AGGGTTGCAACCCAAGACCCCAGCAGAGGTCTGAAATCATTTAAGAGTAATAATCCCTAT
ATATACACGTTTTTCCTGTACCTACAATACAATAAAGTTTAATTTATAAACTAGACACTA
AAACTTAATAATTCTGACAGTACACTGTGATAAAACATTTAAAATATATAAATGGTTTAA
TTTCTGGAATTTTCCATTTCATGTTTTCCAACCACGATGGATCACAGGCAGTGAGTGTGG
ATGAGGAAGACATTGCTGTGGGCTAAAAACCTGGAAGTTCTACAGGAACAATGCATTTCC
ACTCTGCCCTGTCTTACCAGGCTTACGCTTCACTTAGGAAGAAAGTTCCAGGAAAGCTGA
CATTAGTGACAAGTTCATTTAAGATGTTAGATCCACGATAAGAAAGCTTAAATTTTTACA
GCTTAAATTGCCAGGCAGTAAGTAGCGTGGCAGGGCTAGATGAGCATGTGTGACGAGGGC
CTGGTAAGGCTGATCGAGAACAGCAGGCAAAGGAAAAAGTGGTTTTGTTATAATCACCCA
TGATTACTCATCAGATATCAGACTGCCCACTGAATTGAGAAAAAACTGTCAGCCCTGAGG
AGATGATTAAGTTACAAACTCTTGGTTGGCAGCTTTACCCTTCACCCCATCTACAGCACT
GTAACAAGGCCTCGCCTTGTCAAAATGTTTTGATTTTATGTCTCCAATGGAATTTATAGA
AGGACTGAGATCAAACATAATGAATCTTGAACCTAGATTCTCTATTGAAGGAGACCTTTA
TGCTAAGAGTAACAGATGCAATCACTTTTTCTGTATGTGATTTTCCTAGTTAAAATGATA
TTCTTATTAAAGAATATGCCAAAAACTACACATTTAAAGCTGTACACATATTGATACATT
TTGGAAAACTGACTTACTGCTGAAGTTCATAAAATGGGTGTGCGGCCCTCCTAATGCTCG
ACAGACCTGCCCCAAGTGGCCTCTCTGTTCCTAGGAGTGCAACATAGCTTCTGGTCTGGG
GGTGGGAAAATAAAATAAAATAAAATGGGTGTGCAACCCCCCCTTACCTGAGCATTCCCA
GGTGGACCAGAGTATAAGTCAGAGTTTTGGACTTTAACAGGGAAACTCCTGAATAAGAAC
CTCTGTTCTACGAGCCATTGTAATGAGTTTATTATATGGGATCTGGAAACCAACAGAATA
TACCTTCATTGAATTACATGTTGGTCGGCTTTTTTTTTTTTTTTTTCTTTTTTGCTGCCA
CCCATGGCTTTTTAAAAATTTTTTTTAAAAAATGGTAATTACAGGGCCTGGGGGTTTAGC
TCAGCGGCATAAGCGCCTGCCTTGCAAGCAGGCAGTCGTGAGTTCGATCCCTGGTACTGA
TAAAAAGGAAAAAGACAAAAAATAAATAAATAAATAAATAAATAAAAATGGTAATTACTG
GGCCAGGGATATAGCTCAGCAGCACAGCACCTGCCTGGTAAGCTCAAGGTCCAGAGCTTG
ATTCCTAGTACCAAAAAAAAATGGTAATAACTAAAGATCTGATGATTTTTAATTATGCAT
CACTCTTTTTAAAGTGTGATGAACAAGTCTTTCTACATAATGTATGTTTTTTATATGGTA
CCAAGGGATGAACTAAAGACCTCACGCTGCCAGGCAGGCACTTATGCTGTTGAGCTAAAT
CCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved