Cavia_porcellus Locus Mono:276:SNORA40
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:276:SNORA40
Cavia_porcellus
Mono:276:SNORA40
scaffold_291021
SNORA40
1001..1130
2130
CAGTCACAGCCATGAGCAGAAATTTCCATGGAAAGTAGAAACAGACTGGACTGATGGAT
GTTCCCAGTCACAGCCATGAGCAGAGCTTCTGACAAGGAGTCCTACTCAGCAATTTGGGT
ACAAAGAACAAAATACACTGCATTTTCCCATTCTTTTTCACTTTAGCATCCAATGCTTAT
TGCAGAAGCACAATTAATACAAGTTTACATTGGCACTACTAATTTTAAACATCATGAGTT
GTAATATGATACCATTCAAAGAGCACTGTATGTAAAGGAGCTAAATGTAGAGGTCCAAGA
GGAGCAGTTTGGAAATTCTATTTAGGGAAAGAAACACTGTGAACTGGCAGAGCGAGCTGT
AAGATTTCCTTAAGCACTCAAGCAACGTGACTGAACCTGGAAGGTGCTGGGTTGCAGAGC
TGTCTTAAAAACAACAGACAGGAAGGCTGACAGCCCAAAGAGAAAGCAGTCCCACTGTAA
GACCTACTAGTACACTCTTGTCAATTTCCGGACCAAAAGTCTTTGCTACATAAGTATACT
GTCACTTAGGATATGATTATTCAAGAGAACTCTGAATTATCATCATCATTCTTCAAATTG
AAAAACATCTTTCTAAAGTCAATATTCAGTAATTGGGCAAGGGTCTAAATAATGTAGCTA
ATTAGAGCTGCTTTAACTATGTAGTTCTTAGTACTTTATTAAAACACATGAGTGGTATTC
AAGGATTTAACGAAAGATAGGTTTTTCAGGGTATCTTTAAAAGAAAAACCTAGAAAATAA
AAAACGGGGGGGGGGGGTGTGATCCAGCTTTCCTAACATAGAACATATTGCCTACAGGCA
GTCCAAAGTGAAGAGCTCCCCCAAAAAAGATGTGTGCGGGGGTGAATTAATATGAACCAA
GTGGGAGAAAGTACACAGGAAAAAGAAGGAAAGCTAAATAAGCACAGAGATTACTGTCCA
GATGGCAGATCAATCTTTAAGGATGAATAAAAGGAAATACCGGCACTTGTGTGTCTGTTT
TTGTCTAACTTGTGGACTGAGACTTATGGGCAGGTGCAGAAAATAAATCCTCTTTTGCAA
CCCAGAACTCATTGTTCAGTACAAGTTTTGATCCACACAAGAAGGAACATTACCGCCAGG
CATAGTGCCTGTGAGCCTGGCACTCCCAAGACTGAGGCAAGAGGAATGGAGCCTGGACAA
TGGTGTGACTCGGAACAGAAAACAAAAACAAAGAATCATGCTATTGTAATACAGATTACA
GTGATAGAAAGTGTTTGTAACTATTAAATTGGGGTGCAAGACTAAAGAATTGATTGTAAA
ACACAGGATATGGAGCAAAATCTCAGCTCTATAAATTTTCTATTTCAATTTTTATCTTGT
GATATACAAAGATAGCTGTTTTTCTGCTTAAAGGAACATGGATCTGGAGTTGAAGATGTC
TGAGTGGCTCACGTGTGGTTAAATGTAGTAACGTCAGATTAAAATGCCCACTGGTTTAAA
TAAAAGATTGCTGACTTTCTTTAAAAAAACAAAGAAAGAAATACCATTACTGAGCTTATT
CTATATGCCAAGGACTCTGTTGGGTATTTTAATATATTCTAATTTAATCACTATTTTGAC
CAAAATTTCTTTTGAATGTTATGTATGTGCTTCTTAAAATAGATTTTATTTTTAGACTGT
TTTAAAATTAAAAACATTTAAGAAGGCATATAGAATTTCCTTATACTTTTCCCTCTTTTG
GTTGTTCTCTTTTAAAGTTGTTGTACTTCTAATAACCTAAGCTTCTGCTTCAGGAAGTAT
GTATTTGACACATTTGATATTAGTCATAAACAGCTACATAATTTGTGAAGCCTGGCACAA
GATGAAAGTGTGAATCATCTTATCTAAAGACTAATAAGAATTCCCGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved