Cavia_porcellus Locus Mono:38:SNORA1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:38:SNORA1
Cavia_porcellus
Mono:38:SNORA1
scaffold_287627
SNORA1
1001..1133
2133
TAATTCAGATACCTTTTTCATTATGCTTTTTATATTTATTTTAATTAAAGAGTGTTGTA
GTCAAGAGTTGCAAGGAGAACAATTATATATAGGACATAGAATTTATAGTATTATTTTTT
GATGGTCACCCGAGTTAAACATAAGAAAGCGTGGAAATCTGTCCACAACATTAAAGACCT
AGAAAATCCAGCTAAGAGCCTGGATCCCACAGCAATGTCCTGCATGAGTCCAGATGAAGG
CCTAGAGCCCATGACAGTGACTCAGGCCAGTCTGTTTTACAGATCTGCACTGGGAAGGTC
AAAGGTCGGTGGTGGAAGCTAGAACGTCTATGCCAGCAGGGTGAAGGAGCTGTGCCAGTA
GGTTGAGAGTTTTCACTGGAGCCAAGAAGCAATGCTCAAAATAAGGACCAGGGCTACCCT
GAAAGTACAACAGCCATCCTCAGTGACATGGAGGTCCTGGGCTTGCTAGGGTTTCCCACA
GTTGTGTTAGGGTTTGTGGAGAGCAGCTCCCAGACCATATTTGTGGGGAGAGTATTCTGG
AGGTAGAGTTTGATCACCCTTCCACCCCAGAAAAACATGGCGCTAAGTCAAAATACCTAA
AATCTTTGCTATTACCTCGGTACAGCTAGTAAGACTGAGATTTTCAGTTTTTTCCTTTGA
TTTTCAATAATTAATTTGAATAGGTGTCAGTTTTATGCGCTGAGATCTTTTAGAGATTTT
TTATTTGTTTTTCAGAAAAAGGTTTGTGCATTAAGCTCTACTTTGAACGTGGGATTTTCC
CATTGAATATTCAGAGAAGATAAATGTGTCTGTCTGTTTCTGATTTGAAATGTTATGAAA
ATTTAGCCAGTCTCAGACAGACCAAATTCTTTAAATCATAAATCATCTTTCCAGCAGTAC
GTGTAAAATACTGGGATTAATTTTACTATGACTGAACTGATCAAGTGAGCAATTATTGCT
TCACTCAGCATCTTTGAAATGCTTCAGAGTCACTCATACAAAGCCTCATTCCAGATTAGA
ATGAGCACAGTTGATTGGTGTCCAGGACTGGTCAGGGTGGCTGAAACTGGGATGCAGGTC
ACACTTCCATCACAGTAAACATTTATAGTGGTGACGGTGAAACCTGTGACATTTTGCCTA
ATGCAAAGTGTTGACTTTCAATATTACAAACGAATGGTTAAGGAATAATATAGACTCTAG
GTCATGGGCCAGAATACCAATACTATGTATAATTCAAATCCTAGGCTCCCAAGATATAAA
TCTCAAGAAAAACATTGGATGTAAGATCCCAGGAGTTCTGAATTTCTCCTTGTCGATAAT
ACAGGTGGAGACAGAATTGTGGCAAGGCGATCTTGAAGATCAAGAACCTCATTAAAGTGA
CCTTGATAAGTTTTAAAAAAATCTAATGTGAAATTCCTTAAATAAAATTTTATTTAATTC
AAAAATAGTTACTCATACACTTTTTGACTTATGAGAAAATATCCAGGGTTATTCTCAGCT
CCTAATGGGTGGCTTCTGCTAAAATTCCTTCAAAATATTGTTGACATTTTAACTTGATTT
CAACATTTAATTAATAATATAAAATAAAACAAATGAATATCTTTTATTATTAGGTATTAA
ACCCAGAAATATAAGTCCTGCTCTGGATCACTGAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved