Cavia_porcellus Locus Mono:480:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:480:SNORA2
Cavia_porcellus
Mono:480:SNORA2
scaffold_220506
SNORA2
1001..1137
1630
AGGTTTTGTTTTTTCAATCAGATTGTATTAAAATATTTTAGGTATATACAATGATCATG
TTCATCATAGAGAATTTTACCGGACATGATATAACTTGTTCCTTTTATTTTCCTATTTCC
TTACCCTGCCTTCAGCCCCTCCTCTCCTCCCCATTTGTAAAATTTCATTTTGCTTCTCTT
TTTTTCCTCACTTTTTCTTGCTTTTCCCTTCTTCCTTTCCCCCTTTTCCTTCCTTTATCT
CCCTCCCTGTTTGAACATTTTCCTCCTATTTCACAGAACCTATTATACATTTTGGCCTTT
ATTTATACTTTTGGTTTCTCACACCAGAGAAACAATGTGGTATTTACACATGAACACACA
CACACAAATCTTGCAAGAGCATACAGAAACATACAAACCACAAAAACAGAGCAAAACTCC
AATATATGCATGGACACATAAAATGTTCACACACATACACTCAGCCCTGCAAACATATGC
ATGAATATGCTCTGCTGGCCCTGAATCAAGGCCAGCGGTTTCATGACACTGTTGGTTTCA
AACAGGAGCCTAAAGAGATGTCTTTCTATGATCTGTTGGCCATTTCAGAACTTGGGCAGT
GAAATGATCAATTCATTAGAAAGAAACAGCTTGAAGCAGCCCCCACACCCCCCACCATGA
GCGACTGTGAGCGTGGCAGGCTGCAGCGACCCAGGATGGGAACCACAGGCGTTTAGTGGG
ACCCGAGCCATGCTGGGACCTGGAGCACCAGGAAACCAAGCAGTCCCTCCCCGCTTGCCT
GTTTTGTTTTGTTGAACTTCAATATACATGAAACTATGGACAGCTAATTTGAAGAGAACG
AGAGACTCTATGACAGCCATTAGTTACTTCCCTATTGTCTGGTTTTGAAGCCCTAAAACA
CCTTCCCCATTCTGTTTGGATCAGTTTTATACTATGTTGTTTTGTATGAATTCTCTGTAT
GCGAAGACATGGACAACTATTTGGAAGAAAACAGACATATGATAAAAAAAAAAGAGAGAG
ACATATGATAGACAGTGAAGATCTCAAGTCGTCTAGCTTTGAAATTTATATCTCTTACAT
TACTTTCTTATGTTCTAGTTTGTCTGTTTGTTGTGTTTAATTTTACCCCCTTTAAAATAA
AAATAGAAAATAAATTTAAAAAAAGATGAGGCATCGTTGAAATTCTCTCATATGCCTAAT
ATTCTTTTTCTATGAAAAAGTTACACCTATCATTCCACCCTCTAAGGCTCATAAATCTAC
TTCCCCAGTGACCTACCAACTATAGCCGCAGTTACTGGAAAGCACCTGGAGAGCAGGCAC
ATAGGGGTGGAGCCTTGCCCAACACCCTGCGACTTCAGTTCCCAGCATCACTTGCAATAC
AACTGAATGACCAGAGGGCACCCTGCTTCCAGTGAGGAACACCCAAGAATCCAAGGCACT
ACACCTTGCCCAAAGGCACACATTGCTCCCCAAGAAGTCCTCACTGGGGGCCACCCATGC
TCAGTGGCACACACACACACACACACACACAAAGCAATGTTTTCAATTGAATATGTGAAT
TCTTAAGAAGCCAAATTCACAGAAGCAGAATGTAACATTAGTAAAAGGGGTAATAGTAAA
TGGAGAGACGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved