Cavia_porcellus Locus LOC100718740
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100718740
Cavia_porcellus
LOC100718740
scaffold_281097
SNORA32
1001..1115
2115
tcactgagctatatccccaggcctttcttagctaatttgaaagataaaagtttagcaca
ttggagtctaaataagaatagggaaaatgtgaactgaggctgaatagccttccttctgtt
tagagctttagtattttctttttttagaatactcttttcacattctttgctaagttctca
acccaattgatattaaaaacaggaagttgtaggaattttattatgttggagaaatttaat
gtttgttattaatttctctttttaacttcatgactttgcagtttgttttgttttaatgaa
tttagctgtcaaaaaacatgttttacctgtttttttgcaataattttataatatatattt
tcactatcccccaaatatctacaggaaatacctatcttatattttgtgtatctatagttt
tgacaggtacctgtcactttctaaagaaaattttccattttcaacgtttggaacgaaagg
gaaactttagaatcatagccagatataaactttcagttttcgatgtttgttcttctaaag
ggaaactatttgaaatcatagtcagatgttcccaaatagtctcttgctctctaagtctgt
atgaattaaatcatctcaactacatagcaaagctatttcctttcttccaattcaaagtct
taaatacagaaagtagtacattaactgataactcacattatctaacaaaaccccaaaact
tgcccctcttttatatttttgtgaaagagaacacatttttgctgaagctctgtctgcttt
gacagagaaaatatttcttgcccagtgtttcaaatactagttagttaaatcattcttcag
aggaaaagttttctaaaaagtatgtgaatcttaaaatgttacattaaaataaaaaatcat
gattgcatgtgaagattagatctcacagtacaagagtggaaacaactcattatagcattt
aatttcctgaaatttcttttatgaggctgaatagaccagtgTGGTCATTATCAAGGCTTT
TAGAAAGAAGGTTCTCATCTTCTGTGGACTTGACCATAAAATAATTTTCCACTAGGTTTT
CTATCTGTTACCTTGTTAGCAATCAAACTGTTGGGAacattacattgcctaggtgaacac
tgtccagtattatctacagcagctacagctataattcttactctttccatagggtatgct
taaatctctgcaggcttgcttttatcagtttataagcagaggaccccagctgcctccaaa
actcactatgactgaaaaaatatttttatattcttatgcagggtagattgaatgacttca
ttaagcatcaaatcctttgaaagggctatcttgaaaaagcctcattaagtgactttgatg
agtattaaagacatcatgtgaaattccttaaataaaaaaaatttatctaattaaaaaagc
agaccagtgttaggattctctaacacagccagtttcactcaggataagctatagatggta
agcattaatatcctttgttggttttggctctatgaattttcaaagtgcatgattcattca
tgaggaacctatactcctagtatattcattaggaaattctgccttgagtttctgtgaata
tcaaagccctcagaagtgtgcctttgggagctggtctacacagatgtcagagaccctcct
ggaagtctccacctctcagcgctctgctctagcgtttactaagtgttttacaggaagaga
tgaagcatttcggagaatcaattaatttttagaacgactgatttttgtgtctacacccat
tttgagtcagttagatcgaattttgaacttaaaaatactgcgattttcatagtttcacta
gttaaatatttatactttgatattgagtaaaatctcccagttaggtgtctttgaaataca
aatgtgatttacatttacttttcaaaggttttaattctttttggagaaggtcccttgact
ctgatctccacagacccattctatttgtttagctttggtttcttccctacctagagactt
gggtttggttggaggcaggtgagcaaatcaaagtgaacgcgcttgtgtcccagctcctgc
aggagcacatcttatt
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved