Cavia_porcellus Locus Mono:SNORA32
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA32
Cavia_porcellus
Mono:SNORA32
scaffold_7
SNORA32
1001..1116
2116
CACGTAGCATATATATGTATATATCTATATACACATAGCATATATATGTATATATCTAT
ATACACATGGCATATATATGTATATATCTATATACACATGGCATATATATGTATATATCT
ATATACACATGGCATATATATGTATATATCTATATACACATGGCATATATATGTATATAT
CTATATACATATAGTATATATATATCTAATTTTGTGTTTCACATGCATGTATATATACAC
ATACGTATACACATGCCTATTACATACACATAAATACTTGTATATATATGTATATGTGTG
TGTGTGTATGTATACACATACTTCTGCTGAAGGCATAGATAAAGTGCAAAGTCAGAGGGA
ATGTTTTTGGATGATGGGGCTTAATCTTCCAGAATGTTTACATTTTGCCCCCAGGCCTTA
TAGGATTAGAGGTTCTGTTGCACAGTCACCAGAGGACACAGAGAAAAGTCCACCTGAGTT
ATAAACTCTGGCTGCCATCCAGGTATTGGCATGTCTTGTGGCTCAGGATTAGCAGGTGAA
AGAGTGACCATCTTGGCAGGGATAACCCATCCTGAGCTGCAGTGGGCAGTTGGGTTGATT
TTAGACCACGGAAGCAGGGGAGCCTAAGAGTGGAATTCAAGATGACCTCTTGGGGTGCTT
GCACTCCCCAGATGAACTGTGCTGTGAAGAGACAAGTGAGTGATGCCGCTCAAGCCTGGG
CAGGATGGGGCAGAGTAGGGCTTCAAAAGCCCCAATAGTGAAGTTTGAATGATAGCACCA
AAAGCCTCCAAGACTAGTGAGGCGGCTGAGGACAAGGGGGACTTCCAATGGGTAGTGGAG
AAAAAGACTCTGAAACCTCCTGGAGGCCCTGAGGTCAACTGAGACAACACAGGTCAGCCA
TCTTGGTCCCTAACATGTGCAGAGACATAGATTTGTGTGGCCTGAGGAGAAGGCTGGGAG
ATGGATGTGCCACTCAAAACTCCCTTCCAGAAAGGCTGGCTTGGTTATGACCAAGGCTTT
TAGGACGCAGTTTCTAATTCACCAGTGACACAGCCTTAAAAATTCCACCCCCTAGGTTTT
CTATTACCTTTCTAGCAACCAGCCTATGGAAATATTTAGTTAACCTATGGGTTTTATTTC
CACTGCCTCTGTGAGCACTGTCCAATAGAAATTCAGGGCAAGCCACATGTGATTTTCTAA
TAGCTATTTCATTGGTAATGAGATTTTACAAAAAGCCACATTTCAAATTCTCAGCGCAGT
GTATGCCAACATCCCTGGAGCCTTGCAAATGTGCTTCGCCTAGCTAAGCTGGGCTGTACC
CTTCTCAGATGCTGGTACCCAGGCAGTTTGGATGCAGGGACACTGACTGCAGTAAGATGG
CTCCAGAACACATTCTCAATTATTGTAGGATCATTGCTTTACTTGTATGTTATTATGTAA
GGTTGATAGGACAATCAGATTTAGTATCAGTTTTTGTTTTGTTGCTATTGTTTTTGAAAC
CACGTCACCTAAGCTAGCCTTAAATCCATTATGTAGCCCAAGCTGGTCTTGAACTCTCAA
TACTCCTCTCCAAATCCTAAGACTAAAAGCAGGCACCACCATACCCACCTGTCTTGAAAA
TAAATCTTTTTTTATTAGTAGACATTTATAGCACATAATGATTACATTCATCATGGTTGA
AATAAATCTCGACTTAAATTTTTTTAGAGTACACAAATTGACCCTGAAAAGCAATGGAAG
AAATTATACTGTGTGAAATCCCTTGGATAAAAATGTATTGGGCTAGAGTGGTTCAGTGGA
AGAGTTGGGGCTTGGCAAGCACAAGGGTTTACACACACACATGCACACGCACACACACAA
ACACAAACACACACACACAAGTAGAGGCTTAAAAGAAGACAGCCTTGCTGCTGAGGTGCC
AATGATGGGGTGGGCTGACAGCCTCTAGCTTCAGTGTCTGCTTCAGGTTTAAAACAATCT
GAAAGAATGACTGAGCAAAGCAGTGATTCAGGGCCTTGCACTTGCACCCAAAGTGGAATC
TTGATCTGCATTCTGGAAATGCCTGTTGGAGCAGCAGAGGCTTTGTCAAGTCTCTGCGTG
GTGGAATGACAGGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved