Cavia_porcellus Locus Mono:719:SNORA25
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:719:SNORA25
Cavia_porcellus
Mono:719:SNORA25
GeneScaffold_1764
SNORA25
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAA
CTTTCCTTCTTTAACTTTATTATTAGGTATTTTGTCTCACAAGGAGAAAAGTAACTGAGA
CAGTATTACTAAATATTACTCCTTCTGCTCTGTAAGAGTATACTCAGAACATTACAAATA
TTTTTCCTTTGCAACAGAAACCTTCCCAAAACTGGAGATTTAAAGAATGAACAACTTTAA
TGACTACTGAAGTCAATGTGGAGAAATCAAATATTCATTCTATAATAAGCAGACTACTTT
GGCAATTTCCTAATCCTGCAAGAGTTAAATCTCTAGCTTTAGGGCCAAGGGTTTAGCTCA
GTGGCATAAGTGCCTGCTTGGTAAACATGAGGTCATGAGTTCAATCCTCGGTACCAAAAA
AACAGGGGGGGAGGGGGGCTGGGGATTTAACTCAATGGCCTAATTGCCTGCCTGGTAAGT
GTGAGGTCGTGAGTTCAGTCCCCAGAACCAAAAAAAAAAAAAAATCTCTAGCTTTAGCTC
CTTCCCCACTAGCCAAGACTCAGGATATAAATTCCTCAGCTAGGTCATTTCAAAGAGGGC
TTGTGGGAATGTGAAACCAAGAGCTCTTAACACAGTGACCACAGAATGAAGTTCTCCACA
GTATGTCATAGTCACTCAGTAGTGCTATGTTTTCCTGAGGAGAAAAACATGAAGTATTGA
GTTACTGCTCAGCTGTGATTGGAAAAATACTTACAAGTTATAACTAATGGAAAAAAAAAA
TTTCCTCACCTAGCTTAAAGTTTATGAGCCTATCTAAAATAATCCTACCAAATTTCAAAT
ATTGATTTCAACATCACATATTTGCATTATACTATAGAATACAAAAAGGATGCTCATATA
GCAAGCAGTCTTACCACTTCTTGAACTAGGCTGATCAGTTCCATGAGACGTCGACGAAGT
TTGGCTACCTCTTCATTCACTTTAGTGACATGCTGTTCATAAATTTCTGCCAAAGGTTTA
AAGGTATGTCCACCATGCTATGTAAATTAATAAGAGCAGTTTTAAAAGATTTTCTAATAT
CTCATCTGCATTTAATATCACCACCACCCCACTTTTTGTGGTAGTAGGAATTCAACACAG
GGTCTGATATACTTAACAGTAGGCAAGCAGGCTCTACTGTTAAGTTATATCTCAGTCCAC
TTTTAAATTTTATTTTTAGACAGTCTTGTTAAGTTGCCTCTAACCTGTGATCTTCCAGTC
ACAGCCTCCCAAGCAGTTGGAATTACACAGGTACAACACCATACATTCATTTCTCACACT
ATGGATACTAATATTCAGGTAAATATTTTTAAATGAGTACTTTCCATATCCCTTTATTTT
ACTAAAGCAGATCAGTACATATATAATCACTGGGCCCATGTGGGAACTCCTTTAAGATCA
GAAATAATGGACTCTTAACACAAAGTTCACCTTTACCTACATATCTTGGGCTCATTAGAA
AAACAAAATCCTGGGCTGGGATGTAATTCAGTGGCAGAGCACCTGCCTACCGAGCACAAA
CAAGACCCCAGGTGGTATCTGTAACAATGCAAAAAACAAAAACAAAACAAACAAAAAAAA
AAAACACCAGAAAAAGAAAAAGAGAAGGAAAAAGAAAAAAACATTTTTTCCAGGGTCTCA
TGTAGTTCGGACTGGCCTTAAGCTCAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved