Cavia_porcellus Locus Poly:17:SNORA71
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:17:SNORA71
Cavia_porcellus
Poly:17:SNORA71
scaffold_162483
SNORA71, SNORA71, SNORA71
1001..1133, 3947..4079, 6257..6389
7389
TCATTCCTCAATGTTAGAGAAAACAGACGCTGATTTTAGGACTTGTAGCAGGTTGGGAT
TTGTATTCCCTCTATGTCATTGGGACTGCAGTCCCCTGCTAGCACTGAAGCTCCTTCCTC
TTTCCCCTGCTTAGGCCTTGCTTCTTCACGGACATGTGGAGATGGATGGAAACTTCTCCT
GTGGTCAGCACCTTGGATTCTACAGCAGCCAGCCAGCTGGTCCCTCCCCTACACTGCCTC
TCCAGCTCTCCCTGCTGCCAGTGCAGAGCCCTGCTGTTCTGGTCAGTGCTTTGGAGCTGA
ACTTGAAGTGGGAGCCCTCTTAGGTTACCTTTCCACCTATACCTGCAGAGCAGTGGTGGT
GGAGGGCTTGGGTTCTGAGATCTGCCTGGCAAAACCCCTGTGCACACTGAAGCCTGGTGA
AGCACATGGGGATCTTGGGGTCGGGGTTGGGTGCAAAGACAGGAGGTCAGATTCTAGCTG
AATAACCTGATGCTTCTGAGCTTTAGTTTCTGTGAGGTAGGGAAGCTGCAAAGATTTGAG
AGTAGCAGCCTGACTGATTGCATTTCGAATCTTGCCCTGGCAGTGTACACATACTCTGGA
TATCTGTGGGGTAAAGAATTGAATCATCTTGACCATAAATTTGTATTCTGGTGAGGTTTT
CGTGGCAGGTGGAATTTCTTTTTCCCTTTGTAGAACTCAGTGTTGGGTATTGGGTTTTTG
CTTTGAGTTACTTCACCTTATTTTTAGTTTTTTATTTTGAGGTGTTCTCTTGCTAAGCAC
TTTAATTGCTCAGATTATATTCAAACTTGTGCTCCTTCTGCCTTAGCTTCTAAGAGCACT
GGAGTTCCAGGCATGTGCCACCTCAGGTGGCAGCTCTGATGGAATCTTCTGTGTGATGAT
GGCTCTCAGGAGTTGGGCTTGGCTAGTAGTCTTCCATCTCTGGACTGCTGGAGGAAATTG
TGGTTACATGTTAGCTTCCTGGTTTACCTGCCCGTTTTTGCCACAGTATTTGAAAATGAT
TAGGGCTGCCTGTGCCCTGGGCATTGGTAATGCAGGGAGAGAAACTGCTGAAAGCCTTTC
TCTGTGTTTGGAGGGTTCACTCCCGTCCCTTCCAAACTCTGGAGCTTTTGCACACCTTGT
TGCCACCTTTTAGATGTCCCTGGGCCTCTGGTGTCTTGCTTACTGGGTGCTCTGTGCAGC
TCAGTGCTGGTGTCTGAAGCTTTAGCAGGGGCGAATGGAGTTGAGTGCTTTCCTCAAGGA
GCACCTGTGGGTGGGGAGTAAAGCCACAGCAGGGGTCACTTTTTTATCCTCAGCTCATTG
TGAATGACCCTTTAGCAGTTGTTGGTTTGCTGGGCTCTGTATCTCTCCTGTGATCTTAAG
GGGAGTGTCTGAGTCTTACCCCTTGATTTATCTCATTCCTGGCATTGCAGATTCTCAGTG
TTTGGCACTTAGAGAACAAATGAAACTGAGAAAAGAAGAGAAGCCTGCCATGTCATGGCC
CTCAGCATAGTTTGTCACTTCAGAAGCATACTTTTGAGCAAGGCAAATTCCCCTGGCCCA
CCAGGATAGGTATCCCAATGGATGCTCCTTTTGGTGCCAGGAGCCAAACAGGTAGGCCTG
GAGATGGATGACATAGTCAAGTGACCCATGTAATCTGCCCTGGCCCTTAGATGACAAAAG
TGGGCTAGTCTGCTGGTGCTTCAAGTCAAGACTGCTGTGCATGCTGGCACATCCAGCCTT
CCAGAGTCCAGCATTCAGCTTCAGGGCCACTGCAGACTAACCTACTTGTACATAAGATGA
AACTGAGGGGGGCAGGGGATTTAGCTCAGCGGCATAAGCACCTGCCTTGCAAACAGGCGG
TCATGAGTTCGATCCCTGGTACCGAGAAAAATGAAAAACACAAAAAAAAAAAAAAAAAAA
AGATGAAACTGAGGATGTCCCTGCATGGTCTTCTCCTTAAATAAGCTCTTCATATAACAG
ACAGTAGGACACTCTTCAGGTAATTATGACAGTGTCTGTGAAGCACTTCCCACATGCCAG
CTTCTCCGTGTACTGCCCAGGAGAGGTTTGACTAATGATTTTTAAGTGGCTCCTGCGGGC
TTGTTTATTGCAGTGGTGGCAGCTTGATGCAGAGCGGGCATGGACATGTCTCCATTCTGC
TACGAAGTAGCTGGACCATGTAGCTCCAGGTAGAAGTGGGAACTCTGGAGATCTCCCATA
TCTGATATTGGGAACCTAGCTGAGAATCCTGATTTTCAGTCTAAAGAATGCCATGAGAAA
ATAAAAACCAGACAAATACAAAATTCCAAGAATTGCTGGGAAGTCAAAGTCTCTGGATCC
CCGTGCTTCACTCCCGCACAGCCACTATTTATTAGCTGTCAGCAGTGATAGGTGGGGCTA
GCCAAGTATTACAGTTCATCTGAAGACTCCGACCCAGAGGGAATAGATGACATTATGGTT
AGAAGTATCTTGTCCTTGAGTGTAATCCTGAGATGACTCAAGAAGGCATAGATGATCTTA
GGTTTAGAAGAGTCAGTTGGAATCTGAGATGAGTGGTGTCACTAATCCCAATTCTTCCTT
TTCTCCCATAGGGAAATATGCAGAACTAGTCACTGTGAATTTGTGGTCCCTAAAGCTGGG
AAGTGGATGGAAACTACATAAAGGCAGCTTCATTTGGTTCCTAGTTACAGATGCACCAGG
CTCTTGCTGTATCCGTTTAGGGTCCAGTGGTTTATGGTACTCTGTGTTTTCCTTTGGTAT
ACAGGCAGCAGGACATCTGTGTCAAATGCAGAATGGCTTTGGCATTGTACTCCCTCATGC
CCCAGTGCCCATCACCTCACTGCCATGTCCTAGTTTGGGGACCTGCCCACATTCCTGGTT
TCCTCATCAGGAAACTAGGGAGTGTAAAGTGGTAATTTGTCTTAGGTGTACATTGTTCCT
ACTTTCTTATGTGGGGCATCTTCCCTTTGTGTGTCTTGGATGGAGCAGGTTAAGTTCACG
CAGGACAGGAAGGCAGCTGCTGGGTCCTGTTCTCTGTGCTGTTGCCATCCCGGCCCAGGC
CATTTTCTAGGTGTCTGACACTGGCTGGCATTTTTGCCACGCCCCGTGTCTGTTTCCACT
CCTTGTCCATTGTGACTGTAGGCTGTCTTTGGGAATTCAGAAAAGCCAGGAGGTTTTCCT
CACGTGTGAGACAACATTGTTTTCTTTCCCAAGGGATTGGCAGTGATCTCAGAATGTACA
GTTTGAGTTGTCAGTGCCTTCCCTGCCCCCTACTGATTCCTGCTGAGGTTGTCATTTCCT
GGACATGCTGTCAACAGTGCTAAGTGGGCTGTCCATATGCTGGCTTCTTGTCTCCTGCAG
GAGTGTCACACGTGTGCTGATAAGTGTGTGAGAGGTTTTCTCAGGGAGAAGATGATGAAA
TCTCAGGTATGTGGTGATGTACTTAGTTTTTTAGAGCTCACGTGTACTGTCGGAGGTCAG
AGGAGTTTCAGTGCTCTGGATGGGGAGTGAGCTCAAGGAGGAAGGCTGCTTCCCTGTGCT
CCTAGTTCTGGCCCACTTGGCTACTTTATTTGAGGGGCTGCTGCAGAGAAAGTGCTTCCA
GAGCTGGGTTTGGGCTCCCAGCATTCCTGAGGGCGGCCCTCTGTTATGAGGAGGAAAACA
GCAGTGTGTTGGAATGGACAGAGGGCCACCTCCAGACTTAACTCTAGGTTCCTATGCAGT
GAGCAGCCTTCTCGTCTTCTGTGTGCCTCAGTGGATGATGCTCAGTATTGTTATCACTCT
AGCTCAAGAATTCCCAAGAATTCTGCCAATGTTTGCCTTCAGTTCTTGTCAGGGAGCGCC
AGGTGATCTCTAGAGTCACAAAGCAGCTTTTCTGTCCTCCCAGCTCCGTCATTTCCTGGA
ATGCTGGCCATGGTCTCTCCGTCCAGCTTAACTTCTGTCCTTCTGCACCCTGTATTCGAA
AGTGATCGTGGGCTGCCTGTGCCCTGGTCATTGATAGCGCACGGAGAGGAACTGGTGAAA
GCCTTTCCCCGTGTTTAGAAGGTCTACTGCTGTCCTACCAGACCCTGATGCTTCCACACA
GCTCTTAGATGCCTCCTGGCTCCTGCATCATCCAGTTCAGTAAGTGGCCCTTCTCTCTGG
CCTGGGGGAGGTTTCTGTGACTTCTTGAGAGAAGGTTGTGGAAGCCTGGACCTCACCAGA
AGTGGATGGGCTGTGATGGGTGTGGAGCCTTGGCATAAGGCTCTTCCTCCAGGGACTTTC
TCAGTCTCCATCCAGTGTGCCTCAGCAATAAGCAGGGTGAGGGGCAGTTATTGCTTTGAT
TGTGTCCTGGCTTCCTTCCTGGTGGTCAGAAGGGTGGCGCGTTTCTTCTGTGTCTTCATT
TTCCAGAAGATCAGTTTTCTATGAGCCTAGGGCAAAGGAAAAACAAGGAGATTCCCTTTG
CTGTAAGAGCTGGGATGCATCGCCTTGTGCAGGGCTGGGTTGGGGGTACAGTAAGATGTC
TGTGCAGGAGCACACTGGTATTTTCTCCTCTTGCAGAATTCAACAGGTCACCTCCAGGGG
ATGACTTTTCAACTCTAGCCTGTGGTTACTGTGGTAAGGAGCAGGGATAGGCAGAACAGG
ATGTAAGTGAGGGATTTATGGAAGTGGCCCTTCCTTACACAGCCCTCCTGCTGCTCTGTC
TCCTCCCCAGGTCTGTGCCACATGCTGGCAGACAAATGCCACATTGAAGACAATCAATAA
TAGTTGGCACAACAGATAAAACAGACACGCTCCACCACTTTTAGGAGATCTCCAATCCTT
TTCCTAGAGGTAAGCTGATTTTCTCATTCCTAAAATAATGAGACCTTTCGTGATGGTAAT
ATGGATAAGTCAACACTGTGCACCACTGTACGGAGAGGCTTGGTCCTAAGTATCACACTA
GAGATCGTCAGACTGGGCTCTGAGGTCAGGTTTCTGGTCCATTCTCAGGAGTCATGGTTT
TTTGTACCCTGTAAAGTCGGTTCTTTTTCTCTGCCTTTTTGGATAGTGGTGTAAGCAGGT
GATTAGGAGGAGATGAAGGGTGGTACATGGATCCCCAGATCTCCCTTCCCTGGACATCTG
AGTCACATCTGGTACCAGGTTTGGGCCAGCAACCCCTGACAGCAAGACAAAAGAAGATGT
GAGAGAATATTTTTGCGGAGGGCTAGGGAGCTTCACGGAAAGGAAGCCTTGAACTGACTC
AAACTTCAGATTTATTCAGGAGTAACAAAGACATTGTGTTCTGCTGAGGTTTGTTTCAGG
TTGCTGAATTAACTGTTACCTGATTATTCCCCTGGAACCTTCCTTGTTTCCCTGTCAGGC
CCTTCTCTATGTGGGTTGAGAAAATATCCCATCCTTAAGATGTTCAGGCTCCTGGCAGGG
GATTTAGCTCAGTGATACAAGCGCCTGCCTGACAAGCGCAAGCTCATGAGTTTGATCCCT
GGTACCATACAAAAAGGTTCCAGCTCTTTGGAGTTAGCAGCCTTGTGATTCCCCATCCCA
AGTTTACCTGTTGAAATTACAAGGAACTCTACAATCTGGTTCCCCACTCTAGGGTTGTTT
TGTTTTGCTTTTGATCGGTGAACCTTCTACCTGAACATCCTTGCTGCTGGGATTCTAAGT
GTGCACCACTATAGCTGGCCCCACCTGCCTTTTGGCAGAAAAAACGACCAACCTCTCCAG
AGACCTGCTGGTATTGAGTTCTGGGCCTTTTCCTGTGTTACAGCAGCTGCAAGCTGTAAC
AGGAAGTGGGTGAACTTAGGCATCACAGACACCCATACCTGTCTCTTCATTCCTCCATAT
GGTTGTGGCAGGGATCTAGTGGGAGAGTCAGAACCCAGGGCTTTTACAGAGGGCTGGTTG
TGTAGATGCCTTTGGCCTTGCAGGTGTGCAAGTCCAGACTCAGCAGGCGTCCAACCCAAG
CCAGGTTGTTTGCAAAGGGAGCTGGGTTCATGGAGGTGCCGTGTGGAGCTAGCTGTTTAC
TAAGAATGTTTTGGAAGCCAGGTTTCAGGACCCAGTAAGGGCCACTGGCAGGAAGACAAA
GCTCTGACAGGTGAATTTTATAGACATGAGCATGTGATCCTGCTCTTCAGCCCCCAGATT
TTTCTCATTTTTGTCGGAGGGTCTCCCGTTTGATTCCCACATGGCAGTTGCAGGATCCTG
TGCTCCTTTCCTTGTGGACCAGGCATCTGGCACCAGGCTCCTGTACATCTTGGCCCTCCT
CCCTCTGCTCTTTTCTGCCCTGTATTCGAAAGTGATTGTGGGCTGACTGTGCCCCGGTCA
TTGATAGTGCAGGGAGAGAAATATTGAAAGATGTTTTCCCCGTGTTTGGAGGGTCCATCT
GTCCCTTCTGAACCCTGGAGCTTTCCCACATTCTTGTTCTGCAAGCCTTGTAGGAATGCG
GTGCTTCTTGGGTTGCCCCGGGAGTCAGCGTCAGGGGTCGCCATGTCAGCGTCTTTCTCG
CCTTGTCTTGTTTGCAGCAAGCAAGGTGTCTATGCATTGAGATGTTGCCCAACAGAGTTC
AGTCCTGTGGGGGGCGGATCAGGATTCCAGAGCCTCAACCTGCTCATGGAAAGATTGTTT
GAGGAATCCTAGTGAACGCATGCGAGTATCTGCACAGTAGTAGAAAGTGCAACATTAGTG
TGTGCGGTGGTTTCCAAGTCCTTCCAGAGCAGCTTCCTGAAGAGTGTGTGTGTGTGGGGG
GGGCAGGTTTCTAAAACACTCCAGAACAGGAGGTGCAGTGTCGACATGTGCTAGGGCAGC
TGGGACAGCTGGCAAGGGACTTTGGGACTAGGGTGAGCAGGGCTGGGGGAATGCAGCAGA
GAATATGTTAGGGATAAGGTGGGGTAGTATCTTTACATATCAGTGGTGTGTGATTGAGAG
CCCTTAGGTCTATATTGGTGAGAATGGGAGGGCACTCAGTTCTGAGGTGGGACACACCTC
ACTTCCCAGAGGGTGCAGCTCCTAAGAGTTTTGCCTGCTCTCAGGACCCTCTAAGGTATG
CATTGGTATCACCCATTGTGTGCTCTTACCAACTGCTTACTCCTCTTCAGTTCTCTTGGG
TTTCAGGGATCCCCTTTTTGTTACCTGGTTTCTGGAGAGGAAAGTCCTTCGGGTCAAGAA
TGGAACTTGTAGAGCTAGGTGTGAGGTATGTCCTAGCACTTGAGGAGTTGATGCCCAGGC
TGGGTTTCAAACTTGTGGTGGGCCTCTGGCCTTGCCCCCTCAAGTGCCTGGGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved