Cavia_porcellus Locus LOC100722432
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100722432
Cavia_porcellus
LOC100722432
Unknown
SNORA40, SNORA1, snoZ40, SNORA32, SNORA25
6315..6445, 8560..8684, 8929..9001, 9247..9367, 9545..9673
10784
ggtctctcgcacagggattacacacttgcagtcacggtcatgcacgggcctttcccagt
atttgaacagataggctgtgtaaagccaagacagaccgtggcaggacaagtcgcccgcac
tcaccctggaccacacctcgatttagaaatgaaaaagaaaagtaggaaaaaaacccccca
cctgttctcattgatttcactcacttgatcccaagcatttttttctttctttctattttc
cctttttgctttcctttttcttttccgcgatactagggatcgaagccaaggcctttcccc
agggagggtctcactaaattgctcgggctggactcgaatgtttgaccctcccacatcagc
atttggtgtgctgagattacatagatgtgcgccaccacccctggcccgacatttgttttt
atttgccaaaatgttggctattacacttaccgatcactggatgaagcgctcagacctcag
tactgaacacttcccagtcaacttgcctgcctcccgttaaaccagcttaggcccgcccac
tcccgcctcccggcccctcagggtgctccgaagccgctggcgcctcccggctccgcccac
tgtccgtattcgtctcgggagccaatttgtctcgcgagattccaggcccacttttagcgg
agtctggaggccacgcgttcttttctgcggcgctgttggtgtgcggtacgtggtggtgtg
cgctgagcgggatggagttggatgggtaataggaagaagggcgcaatgtccaggctccgg
ccgcaagtggttggcacttgcccgggtgcgggctgcaagtggtcctcggcaggtccgaga
ggccgtcatctgcccggttgtgtgctgctgggttcctgcacggaaggccccgcgcccgga
ttggggcggcggctggcctgtttcggccttgctggagggtcaggcgattgtagtgtagcg
cggctcgtggtgtcagatgtgagtggtaaaactaggtcgagatgggttacctgtctaatg
gtttatccttggcccacgtggcccgaggggtccgccattgaacctccacttctgtaactc
ccaggttatctccgtttgctccggccagacttgtcggctttaaatctcagaatgccagga
ttggaagcgacggccgagttggagggcttctaaacacgttccgagcttttgtgccttctt
tctttgtgagaaggatctcgccttgtattccgggccgagatcggcctgcctcagtcttct
gagtgctggatttaaggctagcgtcaacacggtggaatcgaaagggggatttttaaacca
gctgtagttgagtaatttttaaaatacacgcgtgtgtcagtaatgcttttttaatatcgg
cttttgtttgtccggcattggggctcgacccaggccatgcccgttttaggcaagtgctgt
acaagtggggtacacgcctagtacttttttttttgtatgtgtgtgggactgggtataaaa
tccaggaccttagctatgagccacatctccaaccatgtttaattttttagtttgaaacat
tcctggtaaggggcccaaacagtgctcaaggttgggtttttttgttttgttttgtttttt
gtactaggaatcgaactcagaacctttgagcttgcaggcaggtgcttgtgcttcttagct
aaagcccctgcccctgtgctcaagtttagtgatccttctgcttcagtctccgagggtgct
agtattaccgccttccatcatccggtcctcccttttttttgagggtggtctagctgactt
ggccaaggtgtgtatttcaagagagtatatttagtgactcaagattttctacttaagaga
actaacgaaacatttaggaagtaggaagttaccacttgggtctgttaggcatttaacgaa
ttgaggatttagtgagcttttcgtattcctgtatttgaaatattttgcaagttagtcgtg
ttaaggtttgtaataacttggctgtttttcaagtatactgagaaaatttttttaaagtca
tgggagattaaataatgaaagtaatattttatttaaacttttgtagtgaagattgaacca
acagcttctatagagttgtatttccacccctttttaaaaatttagagatggacctgctaa
gtcactaattcatccagggtgggctagaattatttttccaatccttttgcctcaagagtg
ctgggataacaggcttcaccactgcacctatctaatagtcaccgtttgtttttattgact
ttttggttgtgcattttagcaagaaagtagagaccagagtagcatcagaatactgtttgc
cagaaactttgaattactaaatttccaccaataatgagataatttgacaagatggtttaa
tcagtgagaaaaaatcaagaaggaacactgaaaagggcagtaagtgaaagttccagacca
agaattggatggagatgcagtctaaaggattattactgacttacatagacaggcatactt
ggcctttagactttcttggcacaagtttttcctaggagtacccccttgattttaggaaat
gcctgattggcttaggtttgtgagtaataagctattttgtgttgagaagtttgttggaat
taagcactttcagggatcttgctacattaggtaagtttagagagcataaactgaaaacct
agcctgttaatgaaaattctagttttaaagaaactgaggtggatgttccctagagcttaa
aagtggtaaataatatgcataaattttcagtggcatgacttaagaatttttagtggaaat
tgactgtatatgtatgtcagcacttgtttaggaaggctacatcacttttactgaattttg
ttaatttcagaaacttgtaagacaaagtggataaatcaggaatggatgctaactatatga
tatctgatacagctgtggaaatggaaaatcaaaggtaaatggacttacagggaaactgga
tttaataaagttgcattagagttttgggggttttttttgttgttgttgttaccagggatt
gaactcacaaccaccttttgcttgccaggcaggtgctaatgcagctgagctaaattccca
gccctagagatggaaattaactcatgaagttggtgttaaagataattatctagatttagg
aaagaaactggccaacattttcctagcttatccagttacatatttggattctgaaggaat
tgcttccgaatccaaatatattatactggaacacattctttgtttaggatgctggtatct
tgacttcctctatgaatttcatttttgatggtgggtgttttatttcttagcaggctgtta
caagaagttgcaacagttagccagataacttgtgggcatgtatgtcttctcttggaaaat
aaaatttgtgttttaacaaattgagaccattttaggtggtcataggtcaatgacgatctg
atattgaacccattctaacaagtttttattctgaccatgttctctgacttggttgtaaga
aataggcacttgggggttgtgtattacttactagtagcaagcatttagtaatatgagaaa
atttattttctagtgatagctcttcatctggtagcagcttatttagaacacagtgtgcac
cttccttatctcagcggactccaagaaaccccatgaggaaatttgctcatatacctgaaa
gtgttcagacagattcatcaagtgactcatccatagaaccaagaccactaactttgaaag
ctatttttgaaagattcaagaaaaagaagaaacgtaaaaagaggaaatacaagccaaagt
taactccaagaggaagaccaaaaggaagaagaaacattagaaagtcacaaatagataaaa
aacaaattaaagacaaaggacctaggttcccaattttacagtctgaggatggaaggaaac
cattaccatggaggaaaattttgagttttgaagtgagtttgtatataagcatacatattg
ctaaaataccaatgttttggcttcttttaaattgtcttgaaaaaaagaagtgcaattttg
attctgtacttaaaagttgattccattctatagtttgcacttcacttgggtttctaggta
aaatcttcactggaatattccttaagtgtaactgaagagtgttccaagtctccctgtgtg
tattcccttgagctcatcaaccctaaaacatgacatccattttgctgtaaaccatgttgt
cttaagcttacctgttactttgaaaaagaaattttttttgagaccgtcattttgtagcca
ggctggcttcaggctcaaggcagttagtcctacctcacccctgagtgctgggattacaaa
catgccaccaccatgcccagctaactgttattttctgatatttaatgctaacggtagatt
cttgggatgtgtgaaaattgtatattgggtgtatagttaacatggtcccttgctagtcct
aaaatgttgagaataattataagtgcagtgataagtgttactattagtgtaataataatt
gtgtggtcatattaaatgatgtgtctggtccagaaatgctgaggagttacttttgaaagg
ctaagacacaaaatatgttttgtactttttttaacacagcaagctgttgcaagaggattt
tttaactacattgaaaaactgaagtatgaacaccaccttaaggaatcattaaaacaaatg
aatgttagtgaagatttagaaaaagaagatcttgatagtcggagatacaaatacttggat
gatgatggatccatttctcctattgaagagtcagagtaagttgcatgataaaatggctct
ttgctcatttttaaactattctgtcatgttttgtttcttttttttttttttttttttttt
tttttcccagtctggctattgctatgtagtctagatgtccccaaatgctgggttgacagg
tgtgtgaccattctggctccatttaagccaagtcaaacaaaccatcccatttcaatgtta
aataggatatagtatgttttaatcttgaataataatgttctttaggccatttagagtagt
gtcttaatgctagaaaattgtgtatgatttgtggtacattttaatgttacagaggagaag
atgagagaacacatcttgaacatgatgaatgtgatatcaagttggtagtaagtaactcaa
ttttctcttatttgaagaaggcaggcattggtacaggaattgtaggtcttatttttgtct
tgttttatatagcccagggtggcacaaatgccagtccccttgtctcagtgtataccacca
tatctagctttccatttaaattttgaaagacccagtatcaacctttaaagcaagagatga
aagaatggaaatgttaagttttggatgtatgatgagaaaatgagttttattttctcctat
gtttattttctcctatccaacacaggttcttaacacaccctagcaagtactatacctctt
gggacagcatgttaatataggtatcgctaattaggctctgagaaaatacacaaatgttag
tttggatttttaatttcaagtaaagtagcccttgggtgtatgattattctttcttactgt
attgtgtttttatgcaggaggagagttgtttcataataagttctgaatttccaaacaaga
tgaatgtgtatttacagcaagagaataaagcagctgctttgtctaagaagagagtttcta
aggctagaaatactgggcggaaggcaaaaaagatctgaaaaggagataaagatgtgaatg
tcaaggtaaacagtgtacagaaagtgacttttaggggagataggaagaaatgaccaaaga
tgattaatgtggagatagctgttgctgaagagacttaaagcaagaactaaggagaaaata
aaaattgggacgtttgtggaagaaattaaagaaatacaaattttcaagcactggtaaata
gttgcagtaaccaggtgtcagtggaatactgaaagaaaatgtaagagtcgctgacatcca
accagcttcattaggttattgggaacaccatgttttaaaccccaacgttattcagacaaa
agggacttttactgtcaaatgtttaatcacttctctgggatacagttcagcaacacgaga
ctcttggtttgatccccagcagctgataaacaacttcctaatgcacttggaaaataagtt
tcactatttcaactacatccccttattaacattgtatagttgactgctaagtatgcatgg
cattgattgtacattggcacttgagtatgtttttgtcttaacttagtggactaaaaactt
actgaacaggtgcaaaaataaaacctcttttgcaacccagaactcattgttcagtatgag
ttttgatacatataagaaggaatattattgctatgagtgggtggtacaagcctgtgatcc
caaactcccagactgaggcaagaggaattaagctcaggcatatctgactatctacctatc
tatctttttatatatatatatatatgcaaccttacctcagaaaacaaagcaaaaacaaaa
atacatgatagcctaagttttattctgagactcaagttaatgtacagtataggatatgaa
caaactagactgagtattccagtttttatgctgtagcacatgaagatacttttttttttt
ccttaaaggcttctgtttgaacatgtgcctgcagttgaagatatgtcttactgtgttgga
tcatgtttgtttaaatgtagtaagtaacagcatcagattaaaatttccttgggtttttaa
taaaagattgttaactttaattccagttaggacatttgattgccaaaaacaaactttaga
tttaagcattttttacatacttgtgtggtaacattttttgaaacattcactttgaatagg
ctataaataaatgttagcagttgtattgaaggtcgtatgactgatactgtaactcatacc
tgaattttttccccttaattcaacttagctgttgcaataggcttatatagtatagtctcc
ctgtacactcagcaggctgaggcaggattgctaattggagtttagcctatctaccttact
gaaacaattttttttttgtctttttcctttttatcggtaccggggatcgaactcacaact
cctgcttgcaaggcaggcaattatgccactgagctaaatccccagccccctagtgaaaca
atcttaaaacaaaaaaggcacttgttacttaatactctgttaaacacaattattagaaac
catggagtgatttttctggccattaagtattcatatccactgctattgtcacattgtttt
gctgaagcaatgcacaattcctgctgttcctattctaggctgtcttgaggtctatcccga
tggagcttctgtagctacacatcgctggaaacgcctcatagagtaacattggttttgctc
tactcacaggtctgcttcttaggcctgtgataaagcactacaagacagcaaaaagtatgc
agcaaaaagaatgaaaactaatactttttcttttaactttagatatattgcatgtctgag
agctctgaacctactctgaatagcttaggtaagttttcattgttgacagcataatactat
aagaatagttccagtttacatgatgaatttaactgttcaactgctgcatgatacaaacat
gaactaaaacttaattctgacagctggagatagctattgactgcatagataactttgatt
tactggaaatacttagttctaaatcttttttattttgtaatttctctgtaggaaatgaat
atgaattcatgcatgtgttagagaagtaagtgaaacttgtagtttatcaaggacttagaa
aaattgacaataaaggtctttgcacaaatgtgatacatatatttataaaatgaaaaatgg
gtggctatctttgcactgtcctttgtttatttggcagctgtacagtttttacccaaatat
gtagcatatgtaacctggggacacagctgagcaacagtgatcctgactcttttattgtat
attgaaaccttgagaatttttacacaagcactttacaccgaggtagtcctttgtgatttg
acttttaactgcatgtggaaattgaacagataagatgtttataagtagtgatctcattag
aaaatgtaataaatgttaactggaagtacagtagaggatctttcctcaaatgattgcact
gaatggtatctgcactcaacagtttattcctgctgatgtgttcaaaagacagtgcgacag
gaattcagtgtgcggcatcgttggttttcttggctttgtgcatgttaaacctggtatttc
tactgatacattgtttttctaatactcattttattcatagtcaatataatatttttttaa
tttagagtgtcagcaaggcggcagatccatctaccataaatgtaaggtgttttatatctt
cccctattgttagcgtaacaacaaattataagacagcctcattttagattagaatgggca
ctgttgattggtgtccaaaactggtcaatgtggctgaaattgtcacaggtcgtgcttcca
tcacagtaaatgtttacagtggtgacaatgagacctgtaacatctttcctactactgaaa
aactttcagtattataattgaatgcttatagaatctagattatgtgacaaaataccaata
ctatatatacttcaaattttagactcctaaaatacagatcgtcagcagaaattggatgat
aagatcccaggtaagacttaagtttccatttcaaagaccaaacctacttagaattttttt
gcaaccaaatctataagaaaaatatctaggttttatcggcatgggtgtataatgttgtga
tgactggcaaaatgttcaactgctctgaaagggctgaatgaaaatagcctctctgaacat
gaacatccacactattttagaatatgaggtctctctgaggtgtattttacattctctaaa
gtgatacgaactagatgaaggttgaaattctcagtgtgggtattggattatatagtactt
tgtaaatgtgaaatgtttcctgaaataggagttctgaagttgtcactgtccgtaattcaa
ctggagataaaagaattgtggtaagtaattgtttttatcttacctataaaccactggatt
attatgatggtcattaccaaggctattagaatgaagtttctcatttgctgtggacatggc
cataaaaaaatttcccactaggttttatgtctgctatcttgttagcaatcaacctgttgg
gaacattacattgcctaagtggacactgtcaaatatgtttacaaaagctacatgtaaaat
tcttagtcttacccaccacaaggatctctagaactcactgattatatggcttcttatgca
ggacagatggaatgagtggattaagcagcaaattcctttaaaaaggtacgtgcatgtaac
tatacaggtcatttcaaagagggcttgtgggaatgtgaaaccaagagctcttaacgcagt
gaccacagaatgaagttctccacagtacgtcatagtcactcagtagtgctatgttttcct
gaggagaaagacatgataaagtattgagttactgctcagctgtgactggaaaaatactta
agagttataactaatgtctttttgcttttcagggctatcttgaagatgacaatgttattg
actgaacttaaggaatattgcagaaatcacgtgaaatttcttaaataaaaatttatttaa
tgtccaatggcatgtttactatacacgtggaaagtcagcacatattttttgctcgaagtt
tctctagtgttttctgtaaagggaataaaagttatatgatcagtttcatttatgttaaat
acatttaaaaatcactgaagggttgggctaggaagcctcaccttatgaaattcttttgcc
tttgctctgttttgagcataagcttcttgctttgctttctcttccttttgttgtcgtact
tcagataactgattgtataacctataaaatattcaccagattaggtgtaaatagtgcagc
agaataggagaatcactaggacacagcaaaccaggtaccttagagcccttttgtgcatta
gggcttgtgccatccttctgtcttcaggaaaacacaccttaactttattcacagccttga
ggccacttattaaggaacctgagaaaagaacaagtgttttttttttccttttgtaacacc
tctccttcagaccctacatccaaatcttccttagtttctgtgccctacttccccttcctc
cacacctccctccatccccttgtctcctatccagatacccttttttttttttacctcact
taaatgagatcattattgaaacatgggcattcactgttggtggaaattcaaaaccaaaaa
aaaaaaatatcagcacaattagctaagctcccagaggcagcctgtatactcacagataac
tggataactcatagtaaagcaaagaggctggaaccttagatttgatcctttgatccattg
aagatcgatactttgaacatacctttacctgtagatggcttttccttaactgttttgagt
tgggaatgttcacaaactcgagttttattccgtatttctttctgcctttggtaggatctc
tctataaatgatttttttctcttaacaaatgcttcttgtaagctc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1048, 1130..1223, 2901..2973, 3613..3991, 4659..4834, 5152..5206, 5660..5782, 9752..9784
1001..1048, 1130..1223, 2901..2973, 3613..3991, 4659..4834, 5152..5206, 5660..5782, 9752..9784
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved