Cavia_porcellus Locus Mono:SNORA28
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA28
Cavia_porcellus
Mono:SNORA28
scaffold_1
SNORA28
1001..1126
2126
GGCCTACAGGTCACTTTCTAGGGGAGGCAAAGAATAACATTACGAAATTCTACTGTATA
ATTTCAGGTCTTTTCATTGATCTTGTTATCTCTGGTTCTATTTTGTTTGTTTAACCCTAA
AGCACATTTCATCTTTTCTTTCTCTTCTGAAACTGCTCAATAACTCCTTCAATTTTCCCA
GACTTCATTACTTGGAAAAACTTTATAGTATATCTGTATTACACTTATATTTTTTATTCA
TCAAGATCCTTATCTTTTATTTAACAAGCAGTCATCGAGATTTGTCATGGCTAGTATAAG
CTCTTTCAGTGGTCTGCTCTGCACTGTGCAAGAGTGCATCTTTCCCTCATTTTATTGCCT
TTAACAAATGTAAAACTTCTCTATCTTTTGTGTATCTCTTATCCCAGAAAAACAGATCTT
TCATTTTCTGCTTTGAATATTAAAATTCCAAGACTATTAAAAGAGATGCTGTTATGGTTT
GTATCTAGATGTCCCCCAAACCTCTTGTACTCGTAAAGGGGTCTTTTGGGAGGTGTCTGG
ATCATGGGACTGATAGTCATCAGTGAATTAGTGCACTGATGAGCTTACAGCCAAATGTGA
TGTCAAGAGGTAAAGCTTGGAGGGGGGCAAGACCTGGAAGGGTTTATCCCCCTCCCTACT
CCCTTGATTGCTCTTTGCTTTCCTGTACCATGCTATAGACTGTTTCTCCCCTACCAGGCT
GCCCTATCTTGGAGTTAACCCACTGTGAACTGAAATCTCTACAAACTGAATTAAAATAAA
CCTATCTATCCTTAAATTGTGGGTGCTGGGTACGTATTTCTGGGAGGAGATAGTAACTAA
GATGATTTTATTTAAAATAATCTCTTAGGGGTGAAACCAGGATGGTTAATTGGGATAGGG
ATTCAGACTAGGATAACTATGGTTAAGAACAATTAATTTAATATTTAAAAATAATTAAGA
GATATTTTGAATGCTCCCATCAAAAAAATTCTATGAAGTGCAAGCAACACTCTGTGACAG
ATTATCAAAATAGTCTGTCACAATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCC
GGCACTGTCCTTTCTGTGAGACTAGCCGTTACATAGACTGAAACAAGTTAAAAAAATAAT
AAAAAAACTATGAGAACATATGATTACACATTGCATATATGCATAAAAATGTCACACTCT
ACCCCCATAAATACATTATGGTTTGGACCTGAACTGTTTCCCTTAAGTCTCATATATCTA
AATTGGATCATGGCAATGAATCTGTGGAGGTGCTATAATCAGTGGGTTAGTCCACTGATG
AGTTTATGGTTAACTGTACTACAAGGAGGTGGGATATGGGTGGAAGAGAGTTCCTGGGGA
CATACCTGAAAAGGATATAGCTTTTTCCCCCGAGCTCCTCCCTTCTCTTATAGCTTCCTG
GCTGTGACATAAGCAAGTTTCTTCCATAGTAGGCACTTATGCCATGCCATTTTCTTCATC
TGAATCTCCTGAACATGGACTAAAATTTCCTAATCTAAACCTCTCCATCTCTGAGTTGCA
AATGTCATTCATTTGGTCAAGCAATGATGAGAGTGATCAAAAATGATTTTGATATCAGGA
TTGGGGCTATTGTTGGGACTACACCAGTGCAGTTTAGAAGCCTTTGAAACTGGTTTGTTT
GTAGGCATTTGGAAAGGTTTGGACAGGCTGGTGAGCCCTAGAATGTAGTAAGCTGAACTT
GATGAAAGATTCTAATTGGAGCTCAGAATACAGAATTCTCATAGAAATGCTGATGGAAAA
AGCCAAGTTCAGGAGATTTCAGTTGAGAAGTAGGACTCCATTGGGGCTATGTTATGCTCT
GGCAGAATTTTATCTACGTCTTAATTATGCCCTGAGACTTTACAGGAGACTGAAATTAAG
ACTGGCAGATTAATCTGGTAGGAAAAACTCCAAGGCAGCCCAATATTGAAGTTATGGCAT
AGGTTTAATGTAGCTTTTAACCATATCAACCATGAGCATCTGTACCAAAAAAAGCACAGT
TAAATAATTTGAAGAATTTTACTGGTGGCAATAAAGGGAATGTGTATAAAATTGGACCTA
TCAAGTTTTCGCCTGTAAAGTTTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved