Cavia_porcellus Locus Mono:540:SNORA38
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:540:SNORA38
Cavia_porcellus
Mono:540:SNORA38
scaffold_59572
SNORA38
1001..1140
1365
ACAGCCAAAGGTAAACACCATCCAAGTGTTTCTCCACAGCTAAGTGGATAAACTGAACG
TGGCAGCTACATGTATACATGGAGTATTAATTCGCCTCAGAAAGGAGGGACATTCTGAGC
TGTAATGTGGATCAGCCTTAAAGACCTGATTTTAAGTGAAATTAACCCAAAGAGATAAAA
TTTTCACTTACAGGAGGCATCCACAGAGTCAAATTCACAGGGACAACCTTCCTACAACGG
TGTGCTTTTGGTTCCTTGTCTTTGCACACATAAGAATTGGAGGCAAAAAAAAAAAATAAT
TGTGGATTTGGGGATATCTGGGACCAGCTTGCTCCCTGCAGGCTCAAGATCAACCATCTC
ACATAAAAGGAAAAACAATTCACAGTGGCGCAAGTAGGATGGTGGTTGCCACAGTACGGG
GAGGGCAGGGAGTGAAGAGTTACTGGTAGAGTTTGCAAGAGTCTGAAAACAGTTCTAGTA
GTCATAATGGCTGTGTAACAATGTGACTATACTGGATACTTCTGACACTGGAGAATGGCT
ACAATGGTAAATTTCATGTTAGGCACCTTTTACTGCAATTTAAAAAAAAGAGTAAATTTG
GAAAACAATACCCAGCCCCATGCCTGCTGCCAGCTCTTTCAAGCAATGTTGGTACCTGGC
CCTCCCAAATGCTCTTATTTTGCAAGGCAGATTCGTTTGAAAGAAACAACAATATTACAT
ACCAGTGTTTGAGTTGGCATTTTCCAGGCAACCTCAACACTTATCAATCATGTCACCTTA
CACAGCCTGCCTCAGCCCAAGGTACAGTGAGCCATCCTCTTCAGTCAAGTGACTGTCAAC
AGGGTGCACAGTCATTGTGTACGGGTAACCGGAGAAGAAAAGGGTGAGTTATTGTCCTAA
ATTTGCAGGCAAGTCCCAGAGAGAAAAATAGAACATACAGCCACCCAATGAACTAGAGTT
GCTTGATTTAGCAAGTAACTGTATAGGACTCTGTTGTTTATCTGAGATTCAAATTTAACT
GGGCATCCTGGATTTTATCAGTCTGAAGTATTGCAACCGTGAAGAAGATAATCCAGAGTG
TTCTGGTGTTAACAGGGAGCCTAGACAGAAAAAGCCCATCAGAAAAATATACTAGTTACC
AAAAAAACCCGAAAAACGAAATTTGTAATGCTTCATCCACTCAGGAACTCCTCCTCATGC
GGAGTTTCTATGAACTAAGACTTACTTTTTATACAGACATGTCAGAGGGCAGAAGAAGAA
AGCAGAGAAGGATAAATCAAAGGTAGAGATGGGCGAGAACATACCTAGCCTCTGGTTAGG
ACGGGTTTAGCTTTTAAAATGTACCTTAAAGACCAACATAAAAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved