Cavia_porcellus Locus Mono:46:SNORA24
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:46:SNORA24
Cavia_porcellus
Mono:46:SNORA24
scaffold_24
SNORA24
1001..1118
2104
AGGGCTTCTAAATAATTTTTAAGAGTTATGGGATCCTGAGAGGTGCAGTTGCTTCTGCC
TGTAATCCTAGCACTCTGGAGGCTTAGGCAGGAGGATTGCTATGAGTTCAAAGCCAGTCT
GTGCTACAAAATGAATTCAAGGCCAGCCTGAACTGGATAGTAAAGCCCTGTCTCAAAAAG
ACAGAACAATACCTGATACCAAAATGTTGAGGACTATTCTGGTATATAACATAGACACCA
TTCCTAAGCACTAAGTTTCCACCAACAAAACTTCTAGATCCAGTATTGCAAACTTGGGCA
ACACACATAAACGAAAACTCTAAATTTAGATTCTGTGTTTACAGTTATCCCATTCTTAGT
TTTATTCCTGACCACTCTCAAACAAATGCTACTTTTACAGCGGTGAGGCACCACTAGTAA
GTAAACCAAACCAAATGCCAGCAAAATGTGATCAAAAATTAAAAGAGCAATAGTAATCAT
CATGTGCCATCAGAAAGTTTTAAATTACAACAATGAGATACCACCACACATCTAACAGCA
TGGCCAAAATCCAAGTCATCCATAACATCAAATGCTGGTGAGGGTGTGTCACATCCCTAC
ATGCTACAAGAATGCAAAATGGGTACAGCCAGTCTTTCGAAGGCAATTTGAGTTTCAGAC
TAAACATAATTTTACCATGCACTCCAGTAATTGAACACATTGGTATTTTACCCATATGCA
AAGAAACCTGTAGACAAATAATTATCGCAGCTTTATTTATGTTTGTCAAAATTTGGAAGC
AACCAAGTCCCCTGTCACCTGTGAGTAGATTTATAAATTGTGGTACTTTCATACCATGAG
TGCAGTTATCCAGCACTAATAAGAAATAAGCTTTTAAGCCATGAAAAAAATTTAAGTATC
TTAAGTGCATATTATTAATGAAATATGCAAATCTTAAAAGACAAAATAGAACGTTTTCAA
CTATATGGCGTTCTACAGAAGGCAAAGTTCCCAGGGACTTCCTTGTATCTTTGGGGCTTG
TCTGTCAACTGGGGCACATTCTTGTTTATTGGCAAAACTGTCAACAATTAATTGGTGTCA
GATTCTGATTTTACTGTTAAAAATCCTAGAAGATGGCATGTGACTGGGAAACCTTTTCTA
AACTATTGTTTAAATGTTTTAAGGACTGGGGATATAGTTCAGCAGAACAAACACCTGCCT
GGCAAGCACAAGGTCCTACATTTGATTCCAGATACCAAAATTAAAAAAGGAAGAAAGAAA
AGAAAGTATTTCTAAGAAGCTGAGTTCATTGCTGATGGATAAAAGAAAACATGATGAGAT
ATCAAGAATTCCAAAGTGATAACAAATGACATTGTATATAGCATCTTGAAGTGGCTCACC
AAACTTTATACTCTTGACTATGGGATGGATAGTTTGATGACTGTTCTGGAAACTGTCAAG
GGATTATTTTCAATGTCTGTTTTTGAATTTGTATTTACAATTCTTCCTGGATGTAATTCA
ACGAACTGTTTGATTTGCATGAGAACAAAATCTAGGGAGGTGTTTTAAAAATCAATGATT
AGCCAGGCACAGTAGCACATACATGTAATCGCAGCACTTTGGAGGCTGAGGCAGGAGGAC
TGCTGTGAGTTCGAGGCCAGTCCGAGCTACAGTCCGAGCTACAAAGTGAGTTCAAAGCCA
GCCTAAACCACACTGTGAAACCCTGTCTCAAAAAGATCTAAATAAATAAATAAATAAATA
AATAAATAAATAAACAAATGGTTGTCTGGTGTTAGGGAAGAAGGGATGGATAGGTGGAGC
ACAGAGGATTTTTAAGGCAATGAACCTACACCCTTGTGTGACACTGTAATAGTCAATGCA
TGTCACCCACAAAATGTGCAACAGTGCAGTTTCAGAGTTTGCAATCCATAGGTGGTTGTC
CCTGTGTCATTGGTGCTGCGTGATGGTGGAAGCGTGTGGCCTCTTTAGTCATCTAATGGC
AGGGAAGAAGCAAACGACAGAGACAGGGAAGGGTGGATTAGGATCCCAATACCTGCTTCA
AGGTCACTCGTCAATGAGGTAACAGCATCTGATGAGGCTCCACCTCCAAAAAGTTTCATT
ATCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved