Cavia_porcellus Locus Poly:15:snoR38
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:15:snoR38
Cavia_porcellus
Poly:15:snoR38
scaffold_269158
snoR38, snoR38
1001..1079, 1604..1676
2676
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCAGTAGGTACAGAATAACCTACAGCCTTGAAAGGTCCG
TATTAGACTAAAGATCTAAGTACCAGCATTGGCCTGCTACCACATGATGCCATTAGTACC
TCGTTTGCTTTTTTATTTGTAGTAACAGTGGTTTCCAAACCTGGTTATATGTCACAATCA
ACCTACAAAGTGTTGAAGTGTATGCATTCCTGGGCTACACTTAACTGCCACAGAGGAGAA
TGGCTTTACTTTGAAGCCCAATAACCAAGACCAGACATGTAGGAGCAATTAGTTGATCTG
ATCTGCATTTAGCTCAAGGATTTTATTATAGCAAGATTATAGCGCTGGCTATTTTTAAGT
AGCTCTTGAGGCAGATCTCTAATCCTCTATTTTTAAAAAAACTGACAGCCCTGTGCTTGT
TCTGCAGAGTAGTTTTATGTACTAGTGGATGCAGGAGAAGTGAATGACCTTTGTGTATAG
TGTTGTCTCTTGGCAGGAGATGCAGTGGGTGCAGCTGGCCTTCATTAAGCTAGCTGAAGT
GATGAGTGATCTGTACTATCCTGGGCATTTTACTGCCTGCTAGAATGCATTTTGCCTCCT
GAGCTCTCAGACACTGCTGAGTGACCCTGTCTTAAGGATAGGCACTATTCATGTGCCAAG
GGTGCAGACATTGGGTACATCTAGACATTAGATAGAAAGAAATAGCTTTCGCTAAAGAGG
GAAAACATCTGAATAAAAGGTTTCAGGGGTTTAGCTCAGTCAACAAGCACCTGTCTGCCT
AGCTAGTGTGAGGTTGATCCCCAACCCCCCCCCACACACATTTTTTTTTTTTTTTACAGT
AAAGGTTGGTTGAGAGTCACATGAGGAAAATAAATCACAATTTGTTAAGAAAAAATAGTT
TGCATATATTCTTGGGAGTGTTGTCTGATGCAGAGTGGGAACTGAGTCTGTGATGATTAA
AGTTATCCCTGTCTGAAGGCAAAGGCCTTTCTGTGTGGATTGTGGATCTCTGAAACTCAG
CTTCCCATTTGCTTTCTATAAAATTCAGCAAGATTTTAAAAAGTACTGTGTATATCTTCT
TAAGTAGGTGTTTTCACATATCTCGTCCTTGACAGGTACATTCTCGGTCTCAGTTTCTGA
GGCTCAAAAAGGATCCTTGGGTAGCTGCACTTCGTTGGCGGGCCCGGACCCAAAATGTAT
CATTCATGTAAGCAGAGAAGGCCTGAGCAGCCTTGAGTGGAGTGTTAATTCTTTTTGCAC
GCCTTGCCCTGCTTTGAAGGCTGTGAAAATTGACTGGTAGACTTTAACCTAATTTTGTTT
TTGTTTCTAGGTTGTTTTTTTTGTTTGTTTGTTTGTTTTTTTTGTATTTTTACCGGTACC
AGGGATCGAACTCACGACCACAGACTTGCAAGGCATGCGCTTATGCCGCTGAGCTAAACC
CCCAGCCCCGTTCCTAGGTATTTGTGATATGAGACAGTGCTGAACTGCTTTGCAGGCATG
CGAGAGCTCCCGATAACTGTAAGTTTTGTGTCCCTAAGAAGCCCCCCAATCTATGATGGT
TAATTATCCCTATCTGAAAATCTCAGCTGAAGGGAAATAATTCATTCTGAGGTTTAGGGG
GTGGCTGCATCCTCCAAAGGAAGTTCAGGCTCTATCAGGGATGGAGCTTGTGGCTCAGGG
AGTTGCGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved