Cavia_porcellus Locus LOC100731520
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100731520
Cavia_porcellus
LOC100731520
Unknown
SNORA72
13891..14022
20739
gatatagtttttgtatttcaaccctactgacactgccttacttctgtttctcatcatct
tcagcctagacagttgcatcactggcatttctcccttcaggctctctggcttctattcac
cattctcatgctgccaaagtcataactctaaaatataaacaggattacctcacggcttag
aatcttacaccaagtcgtagattggtttaagtacatagtctgtgttcccagaacagtctg
tcagaaaagttctaagataaaaagacacggtgtttacaccagactattcaggttcctttc
acagtcttctagttaacaactgtgtgacttcaacataaaaatctataaaatacttaaaaa
acagtaaaacacttcatcagggtgtgaatgtggtgaatggtgcgaagcagctaagtgctc
agtacacatcagctgttaatgttatagtttatcatattgtaactgctatctcaataaaag
catcagtatatattattgttactgtggatgacattgtaattcatctgtcattctaccata
acttcaatactgttcatgtacgactgccttactcttctttgctaacctgagcttttctta
cagcagcaaaatcttgataaaacgagaaagcacaagcctgcgccacaacaggaagattct
gtttgatagggaaagaaagagcaaccagcgagctcagggctttagtcccctgtatccccg
cgcccgccactcacttccgggtcagctgccaactcttaaggcaccgcctctttacgcgca
cagcgacgcgcatgcgcacgggccgctcgaccctgcaggcttgggttcattgcttctgca
ttggagtgtttcggggacccttgattttccccattcccttaagccccgctggctaactgt
gacccgagatttcagagctgtggggcgggagcaaacatatctttcttcgcgcgctgctga
agagacgttgtccctgcgggccagggccacaggacgcccccatggcggggccgcgggtgg
aggtggacggcgggatcctggaaggggtgagcgcggggctgagtcagggccggggccgcg
cagctgggggtgggtagggccttcgtggcggacattctcaagtctcttctgcctgcgtcc
caccttccccagggcggccagatcctcagggtttccacggccctgagctgtctcctgggg
cttcccttgcgggtgcagaagatccgtgcgggccgcagcacccctggcctgaggtaagcg
gatcggctgaggagccaggcgcggagttggggggcgcgggccgcggggctgggcctggag
gtactgagcccaggagcaggggcggctgcagggctcagtatcagccagtcctggcggtgc
agtcctggaggtctcagccggcgctgtccgcagtggtggggtctcagggccgcggtcgag
agtggctctcaagccttctcagtgcccggactctgcccggttggtggcctgatgatgcgg
tcttagaagcgccgaggagcaaattcggaaagaggccagagagttttctttatttgttta
ttagccaaaaaacttctcaaaatgttctcccacgtcctaggatattccaggtgcatccct
gtggagaagataggtaagggcagaactgcctctaaggccagaggagacttcgtgtgcaat
ctgctgccgcatagttttaagtcacagaacaggagaggactctgagaggcttttttccag
cttttattcagatctccagaaagatgtgaatacatccagaattaagggaaagccgggacc
cttgactcttgtcggggaagctgggcatgatactagataaatttcagtagcatctgttaa
aggagacttaggttgatgccaaagtggatacctttttatgtattcgatatatattctatt
atatgagctagttcgtagttttttatccacaatttgaaattgttaaaaggcaatttattt
gagctggggatttagctcagcagtgtaagtgcctgcctggcaaatgaggtcatgagttcg
atccccagtaccaccccccccccaaaaaaaaggcaatttattgatatgctagatcctaaa
ttcactttgagcaaatagttgatggcaggaagtcaaatacctaagtagaggaacccaact
cattaaggctgtgttaggtacttactgggtttgctagcgttgccataacagaataccata
gataggatgggtttaaacaactgaaatatttttttcacagtnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagggtgctggcaacattgg
tttcctctgagagcacaagggcagcatctgttctgggccttttcctttgacttgggaggt
gatctctcttgctgcctttggacaaggtggtttctgtatgaaccctgccactgatatctt
ctttatgtcctaatccctttttacaggatgccagtaagactgaatggagactggctcaaa
tggcatccttttacctttttgttatgtctgtttcaaattgcactcatagtgtaatatatg
gggattagggcttcaacatgaattttgggaaacccagtctggaccataacagatgccata
gattatacagtgaaatgtaagcaattttggtggctcctatttttattcttttattttttt
attcctttgtacacttagaattcacagtgctacatcagtgtatgtgtttatagccaaaat
aactggtctcaaaggaactctctaaatgatgcctactggtagtctaagtgtataaaaacc
caaaaggcagccctgacactggagatgtagcacctactatggtttgaccttgttgtttgc
ttgacatcacagttgtgtaaatatatcataaaatgtggggatgtaggcaatcttaatgca
cacgtcttgatgcagtattatgacctgaaggcctcaacatttatctggactggaaatgat
tcgtgatttgtgtgatgggcaactggaaggggcagaaattggctcaacagaaataacttt
tacaccagagaagatcaaaggtggaatccacactgcagataccaagacagcggggtatgt
atcacatgtcattaaagtacgagttttagaattagattcaaatctggtttctaccactta
gtgggaaaattgcttaaccttttttctgtcttagttttcctgaatttaaaagtgtaatat
agttttgaaggttaaagataatgaatataaaagtttgtctgtctagtaatgccattgtag
ctgttaacagtctctgacatttcatcatgtatgtagtatgaggccccttcccctgtccct
ttttggggattgaacccagagtcttgctctttctactcaagtgcttttctaataaactac
atgtccagcccatgttattttgaaagagtcttactaaattgccatgctggcttttcattc
ttcctgtgtaaacctctccggtagctaggataacaggagtgtaccaccatgcccagcttg
aggttggttgatctttctttcttcattcattcattcactcattcattgattcattcgttt
gtggagagaggggtctcgctgtccctaaatttgcagtgctgggctcaaactttcaatctc
ttgcctcagccatcagagtgctggaaatataggtcagcatttactatttttagaatctga
ttttattggtgagaaaataaatattttagctgggcatagtggtgcatatgtgtaattcca
gcactcaggagactgagatctaggggatcacctcaagtaggaggatagcttggactacat
aatgaggccaaggctagcctgaaccactttgttgtggaccctgtctccaaaagagacaga
gatagagagagacagacagagagaggagatactttgtatattggcatactcagagggaat
aaccaaagagattatttgtagttataaagctctggcttatagttagacaaacatttccaa
ttccttttcatttgctccttggcccaactcgctgagaaaaaggattatattacctacctt
ttttgcttccaataccaaacacatttcaatcaataaatatttattgaaaaaattaatttt
tttttggtaccttgaactcagaaccttgcgcttgccaggtaggtgcttatgccactaaac
agtatccccagcccaaaattctttattggtgatattttcttgttcagaatgtgtgtgttt
ttatcaaaagaaggttaagatctgtatttcagcatgtgagagctaattaaattccctttc
aaactgcagtctacttctgaatgtgtttgtttcttgtgattttggagaaggggtataatt
gctcaatctgaccaaatgtttcattttataaaatacttagtgttctgtggttgtttgttg
tgatttttcacatttttgatagtaggaatgaaacttttcatcatgagatatttaactttc
agactttgtaaaatattctaccctatcatcaacttgatgttaggaactgtgtcttaaaac
agggccttgtttatggtagcaactcagatggaagctgttgagtattttagattgtgacta
ttttaaatacaatattcataaatggctgctttcaagaatttattaaaaacatttgaagaa
tgctttacctttatttatttatatactgatttataatataaggaaaagtgtcagaagtta
gctaagacttacccagtgtgttcagtcttgacgcttttttttggcttggagttttgtttt
gtttttttgtggtgttaggtaccaaattagagccatacgcataatagggaaatgttctgt
cactgagtgtcatactcccagcctcgttgggttatcagaaatattttcgctatgaaatat
tttctttaagattcaggattttgtcatgcagacactgacgtataataagtagtacagctt
tttttttttttgagattcttgaaaagacagtacagttaagcttgttctgccttttcctta
ggagtgtgtgcctcttgatgcaggtttcaatgccctgtgttctgtttgctgctgctccat
cagagcttcgtctgaaaggtggaactaatgctgagatggcaccgcagatcgactataccg
tgatggtaggttaatgatagcttcagataatctcatactcttctgtgtcctcattctcta
gctaaatatatcttgagtacttttgtgtatgtttctgtttattttttcatggtatctagg
ttttgtgttgtatattactgtttatagtgaattttttagaagtgtgaagtacaattatgt
aagttatatatcagttactatatctaaattattttgtaaatacaggaagtaagatttgga
aggaaatttaacatcttttaaatgttaaaatattcttagggttttttgttgttgtttttg
ttttgttctgtttttgtgagacagggtctcacactgtagcccaggctgccttgaacttgt
gatttctcttgccttagtctcctaccttttgagtgctgggattacagtaatgtaccacca
tgactgactcctcaggtttttatttttaaaattttaaaaattcaatattggcatctcaaa
caagaagggtggagcattcctaacgtgaaaatctgaaattccccagtcccctgtatgatc
tttttcttcaccaggtttattgtgatgtgattttttttttctcgtgatgtgatgcttgtg
ctgaggattaaacctacagccttgctacctgctaggaaggcactgaactacatccccagc
ttctatggcataattctttacaatttgtttcccctttttaatgtgcactataattttcct
gatttttggacaaacatatacatctgtgaactagcagccataattaagttgcggagtagt
ctcattactctaaaaattttctttagaccctatgtagttaatcctgccctccagtccatt
aatatgtttgccatcatactgtagtgctgtctttattatttttttagaatgtcatgtaaa
ggaatggtactatatttaccatttgaaccttgtttttttaactaccacaataaatttgag
actcatactgttacttatgtcatccccctcccgggaaaaagcataaacctgacggcaccg
ggcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnagatttattttagtttagggtttcagagtattttggaagtggatggttggctttc
ttgatagtgaggcagggagcatttggtgggcacagctgctcatctatcgacagggaagca
gagacagaggcagtgcctgggcttccagtcttccctagcggcaccctctctgctgatctc
ccatctctccactggaccccagctacttcaacatgtgagcctttggaggatctttataaa
tcaagccataaaattattatatataagttttgttttgttaaatttataattttaagaggg
tatatttttaagagtattcttacctaaaaagcagtatgatgaagtaagatggttattcta
attttcttttctgaggattgcttgccttttattactttgtaaggttctttttggtcttac
agtcagctgtacacattcgtggatttggcatctttggatacaaacaactgctgaccagaa
atactgaaaaatgaagttattttgtactaaacatgtacaggctttttttttttttttttt
tttttttttgtcatttcctaagcagtactgtataacatgtatttacataatcttacacat
tgtattagatattataagtaatgcaaggatgacttaaagtatacaagaggatgtgtatag
gttaaacattatgctgttttatattaggacttgaacattcctggattttgatatccacat
ggaggtcttggaaccaatttctctgggtaaaaaggaataaccatagtgaagtttttttga
tacagaatattgccatggagtccaagctggcctttaactcactgagtatcataggctggt
ctcaaacttgcagtgatcgtccatcagccttccaagtgctgaaattagaggtgtacacca
cacctggtttatagtgaagtttttaagctaatcagaaattggactttgaaggtgatcctc
aaatatttccagttgcttaaaataccttaaatgtgaaattaattcataaatcaatgatat
gataaagatttctttcaaaaagaaacataactgttccactaatctaattaagattacttg
gatttaatattataaaaattccttatatctttggaagtctaaaagtactgtgttctttgt
ggatattcaaatttcaaacctttttatttagagattccattaaagtgcttaaagtaaatg
cttgccctagttttgataaaacaatgtaaaaacggtgaaacaaagccaaagtctcttcat
aaaaacttttctgtataagataagaaatttatagtactacatgtctctgatgtggtacca
cttagtgtgataacacagtgacttagggtggaaagggtaatcgttttacctgtaagtggg
ttagaatctgatataacttctctccattaagtggtgaaagatattaatggcctggttaag
gctgatggagaaagttaatcatattactctgtatattagagagttttcgtgtcctgggac
aaaatgacctcacatccatataggaggaaaggtttaatttggctcatgggttagggtttt
agtctgtggtttcctggctccaaggcagaaacagcatgatggaagcgcatggcagaaaaa
agtgcttagctcatgcagagagagaagggacaagctggggaagagataaaccctccaagg
tcaggacccaaatacaggctgctttcaaccagacccagctcctacgagcacgtgcagcta
taaactcatccatggatcagtccaccaatgagtatggcacctcagggtccaatcaccttt
caaaatctccagctttcaaacaatgagcttgttgggaagagtctaaatttaatcatagta
cactctagaaagaatttctctagtagaatgtactggttagatgtatttttgctgtttaat
agtaattaattacttgtgtggtgttttcatgttattttatgatatgtgtaagcaaaagta
ataatattttacttttttttaatagtattattgctgagacatccactggctgtttgtttg
ctggatcatcgcttggtaaacgaggtatatataaatgataagactgatgtaaagttcttt
gtcaggattgttgtgttatagagaatgattgatgacaggtttaagaagatatggataatt
aattctgtttttgagtcaattaaacttttaaatctttcttctaactttatacttggaaat
ttttcacatctatttaggtgtggtggcacgtgcctgtaatcccagcacttccaaggctga
ggcagaaggattaccatgagttcaagtccaggttgggctacataattgagattctgtctt
aaaaaaacaaacagaaaattttttttcacacctatagaaaagttatatgcctacttcagc
tagtcatcaacacatctcctggattcatcagtcttgaacatctggctatgtactgtttat
atttctgaatcatttcagtgtgagttacagacactactcactcctgagtactgcagcatt
atacgtatgtccaaaggatgctgcctgtctaatcccaatactcttccacctgaagaattt
gttcattgtgtgtatttataccagatatacctggacttcacaagccgtctccaaaatggt
gtttagagccatagagccatgtgtggattttttgtgggggtctggtcagtttggttttta
gttttttttttttttgtctttttcttttttatcagtactggggatcaaactcacaaccac
acacttgcaaggcaggcgcttatgccactgagctaaatccctagcccctggtttttagtt
ttttgagacaggctctaacctatgctggccttgacctcctgattcccctgtctcagcctc
tcaggtactagagtaaaagtagtgctctgccgtgtctggctttctgcgtttttaaagcac
acagagcatttggtagtcatgtctgtttagtctgtcttttagtacagaatattctcttta
ctattttttttttttccttgcatggtgtaaatgacattttgaaaactctaagccattttc
tcacagaatatcccacgatttggatttgcataattatctcataatcagattattctgatt
aaacattttaagtgagaatattttgtaagtaattttgtgtacatgtccctgcactgcatc
atgggacccatacagtcagtttgtcctttattggcaaggctgatcacatgattaagggag
ggctcattgaaatgtttgctatgccataaagattccttttcccttcacaattaataagta
gtgtgggacaataccttgaagtattcggattatcttatttccatacaattcaagccagtg
gttctgacagttactgtgattctttcctgtgccagttattacactggtgattagaaaata
ctaaatatttttgggaaagggaaatgttaaagatttgcattttaaggagaaaaaataatt
ccatatatttgtttgttaatatttacagttacttttaaccagtcagagaatttctagttg
tttgtaatagctgattactttatttgtactttgtactattatctttaaaaatgtttaaca
tagctgtgctgtctgatctcattattaccactaagtataaaagtgtattgtcttagtttg
gtcagtgtgtagactagatactagttatgcatcagtgactgaataaataaaattaacatt
tctagttgacctcaccatgaatgaattctgtttaaaactctgcttttttgtgtagctagt
agataggtattgtgtcagtatcatttgaaatttttagaaatacaaattttgggacttatc
ctagacctattgttaattctcagtggcttagctcgctggtagagcacttgcctaccatgt
acaagagcctggataaaatattacagtcaggatttttgctagataagtagcttgtagttc
ttgccattggaggaaaactgagtgaccgtgcaagatggtggtgatgttaattagtttcac
taaagtaactgtgttactatagaagtgtccttagcattatatttatatcttagatatatc
tatattttttaaaagagaactgaggaaaatgagggacaaaggcaaatgctgacacaaaag
catgttctgtgtttaggcaactttaagtacgcttgagtacagggtctggatatattgata
gagaatgatgagatgggattaacaaaggccagagtccgaaaggctgttgacatctgaaaa
gaagttttatgtttcatcctaagaatataaaaattttaaggagggatgagagatattttg
gaaattagttctcatactttatgctgtataaagaattaaaagaaagccatgctgaaggtt
gaaagaccagagtctattacaactcagccccctaatggggaggttatgcatcacagaatg
taactaccactagagaagtgagtactgactagtagtagtttatttagaaaggttaataga
cagtttgttcccattggatgcgggaggtcaggaagaaatgtgaagagtgaccttgtaaat
gtcttagtaatggatgcatatttgcagcttgtgtatgtaagaggtattttgccagggtac
atgataattttagctgtgtctcattgacattgtaaaggaccattattctgtagttctttt
acatggaatttgttgagcagccctgaaaatttttcctgatattctatcaatattttcttt
ctcattttgtgagaaaataacatttactttgaagttgtttttggatagtacacatgtaga
gtgtgtattacttattcttagacttacagcagtgaaaaaaaagcaacagacttgctgaga
ttattggtttcttctggtactttctcttgtttcctgttagatgtgtcagccaaggggaat
gttgttagtaaatggaaaggcagtttgggatcttttttctaaatggaggtcatctgtata
ttaatgatctcagagataatatcataaccttcattatctaagtcctctctcatttctgat
ttaaattaactggaaaggtactgggcactgaatcctgatgtttaagagtttttaccaaat
gcaacattagctggttattacagcatatacggtagccacaggaagttggaactagtcatg
tttttatcattgtcttagttactaaaactattttgattagacagttacctggaagtatcc
ctagaatccttttggctgtaggtttgttttttttgtttttttgagggaggatcttgctat
gttgctcaggatggccttgaactctgtgcagcccaggctggcctggaatttgtggtaatc
ctcctgactcagccttatgcgtgctgagattacagatgtgtgccatcacacctggctttc
cagctgtaacattcttcaaatctgtaaaaatggtgacattttatttaaatcttgatgttt
tgaattgaagcagtatgttataatagaaaactaatagcaggaagacttaaattttagttc
tctgtctaaattatcctatgtattttgggattttcttaactgaaaaatgagattaaataa
tgattacctaggatacttcccaactttatataattacattatgaacacagtgtagagcta
gggatataacttgattggttggagcatacagtggttactgagtatatgagaatccctggg
ttcaatgtctggccccttggggggaaaaaaaagaaaaggaaagaatatattttgtctttc
tgttactaaatatctgttcattgtttgattattcctttttttttgtctttttcattttta
tcggtaccggggatcgaactcacgaccgcctgcttgcaaggcaggtgcttatgccgctga
gctaaacccccagccccctgtttgattattctttgtttttcccccttgaagtgctaggtc
tcctgtatgcttgactagcactttaccacctaactatagccccattcttgcttgtttatt
cttgtctttcagtttattatgttgtttagtattagagcatagcaatctgctaagatgaat
tatgcctctaactaatcagtcttgtttcttggctcataggaagtactttatatgattaat
tcatatatatttctgatatcctaaagtaagtttcttcatgttttctgttcaatctgatag
ccattttgtattttttgtccttttaacaagctagtagatacccacatcagtgagcattca
ttttaatatcctgtattgtaaaacattaatgttataggaggctgaagcagaaggattata
aattcaagcccagcttgggcaacttggcaatttagtgagaccctgtctcaaaagattaaa
aaaaaagaggtggggatagagctcagtgagaaggtcctgggatcagtgcccagtactaca
aagtaaaatgaaagaaaagaaaacaaacacacattaaaattaaagacactgctttttaaa
gaagcactgaaaatatcagattatttgtcaattcaaaaagcattgacatttaaaattttg
ttcctttgggaagagaggaaagcattatactgataagcagaattctcacatgttcatcat
ttgttcagttaccacagtctgctagaagtaataataactgataataatgtagatcctccc
tttcatcattcactgttgagtaggaaggaatatgaatggctctgagaaatattttgcctc
ttgacagaaaactttagtgttctttggactgtacaatccagttttggaatattttaactg
aaatgcgtggtaacagagtgtttgattttttaatttatttagatttggaatatttgcata
taatagtgaaatatcttggaatgagcctaagtccaaacatgaagttaacttgtttcatat
gcatttcatacgcataatgtaatgataattttatatagtattttaaataattttgtgggt
tgaaacagtttcatagtgtgaagtttccacttcctgtgttaagtcagtcttcaaaaagtt
tgaaactttggagcattttgagtttcagattttcagattaaggatgtttaacctatgtta
taaagccaagacttctctcacgtccttcatcccaattttagtcatctttcaagaacctgc
ttaagtccttcatgctctataaaaccttctgaaataattctagaacctaactggcttttc
cttctctaaactcctgttgtatatatgatttatattgaagagtttaacacttcactatcc
tctaattctttaacacatgactaacatgtttcctgaaaataagacctaatgaccagccta
accagaaccagccctagaaggtcagggatcaaactcacaaccttgtgcttaccaggcaaa
cacttgagccactgagcctggggctggctttttttttttttcccagttagattttatttt
tagggaaacatgagtatgttttatacttccttaacaaaggaacaagtaatactgagtacg
cagtactactgttatcattaatagcttattatggattgatcttgggaaaagattctttat
aaatattgtctctatttttgtgacagctattatcatcttcatctaaaagaactagaagag
gctcagcagcttatttaagaatgctaggggtctgcaaatattctcgctgttctgattgtg
tcataatcagggcaggctaaacatttgctatagtaagaccatgcatgtgtccccagacct
tgatctttccctaggtctggttttataaatgctgctgataaatcaggtctaaatagggtg
aattttcagatttgtctaaagaatgtgtgacctaagtcaggaaattctgcagttaccagt
tgtcattaaatgaattgtaaatttaaaaaaaaatgctggggcagagagtgcagctcacat
acctctggtagaacatacatgtgtgtagtatgcgtacggccttagattgtcgcctcagca
ccagaaaggcaggaagatcaagatttgtatagcacaacatattttaaaccatttcgtaca
gccatattaatatttgaccaattggtaatgaaaaactttattattgtaatacctgctata
aaaaagagttaaataaagttgcaaattaaaatacttgtgggaacaagactgccacatttg
tagtgaagaataaccttaagcgagttaatttgaaaaattatattacttctgataggctta
tttttactcgagggtttggtgtatgtgtgaagagataggaagtagaaggggtaaatattc
tgatgttcatttgttacatctgtttaaatcttaaagggaatagaaccttaaaatagttga
cctgagaatgttatttgcttttctttagttgaaattaattccctgagtattaaaaatctt
ttaattctgatgcctggcgaattctaacttgtataatcttgacttttaaagtttgaaatt
gaggcacaccattagagggtcataacttagttataaactggctttataattagtactttt
aaacaggccaaagcagcctgtttcttttttctacctgtgtatttaaagatagaacctgtt
tgcatatgccaagtccgcagaagggcttatcctaaaatttgcatcttataaatttagaca
cctaaaaaaatgtaccagtgctaagtgggatttgtcaaacctgttgacttgcagtaatta
acttaggttttttttttttttttcacattattcctctcttaggtgttaatgcagacaagg
ttgggattgaagctgccgaaatgctattagcaaatcttagacatggtggaactgtggatg
agtacctgcaagatcaggtaatgacactttgaggatgaaaacctgccagcctgtgagact
tgtacattcagaaattagatcgagtataaattaaattacattaagttcctgacttatgat
tgagttccattccaggagaatgtttgtaagttcaattcatttgtaagctgatagaaagag
tcttacacagggtacttgtgaaagttcatgactcaaatgttgtaagtcaggtactttact
gtattggtcttcagacactgatgagggaatcctacttaaattatttataagtatcccctt
ggaatttatattctcatatttgtatctatgtcttacttgatctattcatagcatttggca
gttactttattcttgaaattctggcttcacttggtcggaaataatgttatctttcccctt
aaccggcctccttatcctggtcttctttgctagattgtttccttgtcaacttctgaattt
tagagaggcctcgtgcctctttctgttatctatattcactcccttattttgtccaggctg
aaataccatttggatgctgacagctcctaagtttgtgtccctgcttagacctttcttctt
aactccttattcattatgtccccatgcttgccagtatctccacctgcaaatcttatccac
ttctcaaatttaagacatttgctcattttgggagtgttattaaatgtttctaaataagat
cctttgttctcttcgtgtattttccttcccagcataacttttccctctttaccctcaaat
cagcagtctacatttagaaatgtattctttgtctacggccataccaccctgaacacgccc
gatcttgtctgatcttggaagctaagcagggttgggcctggttagtacttggatgggaga
aatgtattctttggtctgtagatgcagctcagtggtggagctctttttcgtctaaggtgc
atgaggtctgggtttgttttcagtaaccattttcttataaccactgtttttaatgtccag
ttatttcgttcttgctcagatttattctgtatcctagtaattctgtattagtctattgcc
attcaaaaaattttaaagactaggtaggagaaacttatattttacatataccaattgcag
agatagttggtctaattccatatcaactttcaactccatattttattcttaacattaact
ttaaaacttcaatattgaagtgtgtgtgttgacataaacatgtaatctagtattttggga
gacagaggcaggaagattagaagttcaagtcccggggctggggatttagctcagcggcat
aagcacctgccttgcaagcaggcggtcgtgagttcgatccctggtaccgataaaaatgaa
aaagacaaaaaaaaaaaaaaaagaagttcaagtcccacctgggcaatttagggacttagt
gtgactatgtctcaaaataatttttaaaaagggctgaagaagagctcagtgtgaaggccc
taggttccatccgcagtaaactgccatcccacctgcccccattctgtattgacagctgct
ggtaagcatttctattccacacacctaattttggataacacagattttctgtcttcttct
aagaatttgtggaaatctgaagaaatagaaatttttttagctgttttgatttctagtatt
ttcattacagacaacagtaaaattataatctaaatactaataaatgtatgagaattttct
tcttctttcttttttcaatagctgattgttttcatggcattagccaatggagtttccaga
ataaaaacaggaccagttacactacatacacagacagctatacattttgctgaacaacta
gcaaaggtgagtattctattagaaggagtaatttggtcgtattttaataagcaagaaatt
cagtaatgatcagaactgctgtcaccttagtgcttgcatgtggcaggcacttggtaactc
agcgattatttgaagcatcttatctgaattatctgaagcataggtgactatttgttgtta
ttcccattttatgtatgcgttaagtaaattagggaagttaaattgtctgatcccatgtca
tttcttagtggcagagctgggctttgagcaaacctggggaagcatacttcaaggcccgtg
ttaaaagccccgtggtactatgtgacagaataagaaagtgtgtgtggatagaaaggtgat
gtcacaaaggattcaatatttatataaaatttaaagacctttttcttctgattctgttgt
ggaatatttgctgagatactaatacttattaatccttttaaatttagaagagtagattta
caatttgacatttaatctcatttgtacctttttggtactgtttttaattttaacaaaaga
gtaattagtgtcatcacaaaactaatactaatttccttatagaaaatacacagtaatttt
cccttgccagtaaaatcacttttaaaatttaagtgttttctacttaaattgtctctctcc
attttttactatgtgcatcttcatttcttgcttttttctataatatgtagcatttttttg
ttttggtattgtctgtataatatatctttgtaaagtcataaaatttatgactcagtttta
gataggagggtgctgaagcatttttaaaaatttacaagtaatgtacactagttaaaaaga
gaagcagcacagatgtatactaagtgcaaaaccattgccctactgttgcgtttagtatgg
ttcttaataatattgagagtatttgttgccataaagaaaagtaggttttagttaaactgt
aggaaaagtctgatgacagttgaaggtaaatcatgtctggtgatgaaaagttaacaattt
taaaatgcttatcctgtgtttatagcaactacttgtctgtctcttgtagactgatctcta
tagcaaggagcaaattttattcacattttacagcactttgcatgtactgtagtaggcact
tccacatctctagtacagtttgcttcatgttatttgatgtgactacattaaggcaagttc
tgtgaagttctcacttagctttattcagttttgttgtattttcactgggttgaagcaagt
tatttttctgtgcctcaatgcagtagtacatttgtaaactcagacacttgatctagtcag
tttcttaaggcgcttaagtagatttaaatgtagactagaaatgatttccataactgttgg
tggtatttcacagtgtaggcaatatgagaaaaagtaaacacacatgttataactagtgaa
cacacatgttataactacataaaaaaattggttatctagctcagtattcaatgttcattt
attctacagtaatttcagatgtccactgtgtgtcagtatgctatcacataatactaaaac
taaaagaatttgtgaacattactattcggtatggccccagaatgatcgtttttaaattca
aagaatcataagattttaatcatacttgcagtttctttgccacagtctacatagttgttt
tgattttaattcaatttgattaaattttgaatttctttaattcgattttattaaatgttt
caaatctgggcatggtggcgcacatctgtaatcagtcccagcactcaggaggctgaagta
ggaggattgccttgagttcagggctagcctaagctatatagtgagtttgaggccagcttg
aagtacatgcctgaagacctgtctcaacaaaacaaaacaaaaactaaaatgagcagtatg
atttaaaaatgatcatgtttcctaaatacagacatcagatatttcaaagcagcctcaaca
agtgaaaatacagtgttaattccaataaatatcagagaaaaggcttgagatgtggctcag
tagtagagtggttggtgcaagggcctggatttgatcaacatgcacaaaaatgatggccca
gtgtggtggtacatgtctataatcccagtacttgggaggctgaggcaggaggattgctgt
gagttcaaggagactctatctcaaaaaaaaaaaaaaaaaaaaaaaaagagagaaagaaaa
tgaaaatgctgcttataccatcacactgccttcttccctcccatctctgaactaggtctg
tttgaataatgtgtttagggaattaaattggcaggacaaatttagtgacatttaatgata
attttatacttggcaagataaatgttaaatgtttcagttctacatttcacagaaatttta
gggaacacagagaggtatcttataaccataagttcagatttcaaaattgaacttgccttg
attaccctcctggggcttctgattcagtggatatagagtgggacctaggcatatttattc
tgacagaactccacaaaaacgagaaagaacggcagttctggaactacatgttatctctag
ctattgaattttctatgaatcatttgatttttgtgtctagtttcttcagcaaatgtgttt
ggtactatcactgcctacataagtaggagttaaaggctcgctcttctgtctttatagtaa
atattcttctgctttcaggctaaatttactgtgaagaaatcagaagatgaagaagatgcc
tctaaagacacttacattattgagtgccaaggaattgggatgacaaatccaaatctatag
ggtatttcactcttaattgcactaatttatttcatacatagcataacacagtgaataaga
ggtaacttactaaaggaccttgctaaatttggagttgagaaatgatgctctagatttgta
aggatgctgcatcaaagtaatcacactttgaatatctgctgcaaggcagacaataagagt
caatgtatatgtatgatagctgatttcaatattaaggtattgaataaaatactcttttta
cttgaaggtaatggtggttttcttttttatgtgttacagatatagttaagtcaagatata
gattagatctatccacggtttggctttctgaggtttcagttgcctggaatcaactgtggt
ctgaaaatattaaatgaaaaattccaaacctaagtaattcagaagtaatttaaatggcat
tccattctgagcaatatgatgacctctcacaccttccattttgtctcgtttaggatgtga
gttatctttttccaatgtcacccatatagtatacatcacccgcccattaatgtcttagta
gctgtcttgggaatcaaatcaactgttggagtacagtagcgcttgtgttcaagtaacatg
tttgtttttcttttttctttttttttttttctttttcctttttattggtaccggggatcg
aactcatgactgcctgcttgcaagcaggcgcttatgccactgagctaaatcctcagcctc
aagtaacatgaatgaccccagtgtgcatgagtagtggtcagttcaaagatgtcaaatgta
aagagcttcctttaggtatcatctcatatcgttacaagaagggtgggtatgctctcagat
actcagaaatgagaaaccatatgaggctccctttggcataacacagtgtactgttttaca
gtaaacttttttttttacaagtggtgtactctaatgaaaaaaggatagtataatatacaa
accagcacacagttgatttttattatcattttcaagtttt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1152..1252, 2970..3113, 5041..5168, 8245..8303, 14982..15076, 16821..16925, 19638..19739
1001..1045, 1152..1252, 2970..3113, 5041..5168, 8245..8303, 14982..15076, 16821..16925, 19638..19739
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved