Cavia_porcellus Locus Mono:428:SNORD89
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:428:SNORD89
Cavia_porcellus
Mono:428:SNORD89
Unknown
SNORD89
1001..1113
2113
ttttttgttattttgagttgttcttttatcattatctgcaggaagcagcattagcatgc
tgcagataagaccgtggatccagatgtgcatatcaaaggatgaacagctacttattaaga
aaaacttttctttctaagcccagcttctgttcaaaggaagaataaagcctatggcgttag
tgacaaactggtaattcaatgccttgtcaccgccatgcattggaatgggaaaaaagagag
aggtcaaagaaattggtaaggtccacattttggaaagctgaaaaggcagatctagtgtaa
acgttcacccctctagacacatttgtatcctgctgtgtttattcactgttttcttgggga
aaccactgagtcccaaatggactagccgctctgactaaggatgaattttgaattaccaaa
tttatttttagaagagtggaatgtgttgacattgaaagcatcctatttcaatgcaacaga
gctgagcttcccctgcatttgaaagtgtgctaaaaacacaagatgcgcctacatagacaa
gccctggaacagtctgcaaggcaaatctagaagtctcttttaccatcctgcttctaaggt
cagagtgctttcctaccctccagtgtgtgactccctcgcagaacttttatatgtatcgct
atgttgttaaaaggactgtcataccgtggcatgcttcctttatctctcttagtctaaaag
acttgccaatttttctactaggaacacataaatctgcctcagtctttccgatttttacat
agtaatttctggcatcggtgcatataaccattttcctcattggaacaaatgtaaatttct
taccctgtgttgctgttggaaataataacttgataggtctgctttagggctggtctcctt
ctccttgtatattacttttgatttgtttttcctattgtccaaaaaagatttgtttcagta
actgggcaatgttttgtgcccatatacttgagcctaaagtaAATTAGAAATAAATCCGTG
AAGAATGATGACACAGTGTCCTGGTCTACAGTTTGCTCTCTGTGGGCACACGATGACAAA
ACCTCCTGCAGCGAAACAGCAGGCTGACCTCAGCagtggcaggtggaaagtgggagcctt
ggacctggccgggcagcgggtgcctcggggagccgtgcatgagtctggggaactgccagg
cgagagagtgtgagtcactgggtgactgctgagcacactcaagtgtgtttgttcataagg
gaggagatcaaatcagcgtgtagacaatgcaaaaaaagaaagaaaaaggaaggaagaaag
aaaggaaaagtgttgcttaccttttcttttaacattttagagaactgtactacataaatc
aattctaagagcctctgggttttgggttccccccccccctggggtttcttaaactgagaa
ctaacaaaatggcctcaattaagtttttacatgtattctttctcaagttaactattggag
tcttaaatctgtctgtgaagctatcattagagtcttttgtttttcatttttaaatatatc
attagcttcctcttttgggaaatcaaacaaacaatgaagtaaagaaactttgcccagggg
catagagctactcaattaatttactcataaaaattactgtagttttttgttgtggttttg
ttggttttgtttgtttgtttttggctttttgagacagggtctcactacacggttcaggct
ggtcttgagctcactttgtagcccaggatagtcttaaatgtgcagtgatcctcctgcccc
agcctcctgagtggtgggattacaggtgagccaccagacctgcctttgatatttgtattt
ttttttttttttttgagagaggggctcattgagtagttgaggttggcctggaacttttag
tgatcctactgcctcagcctcctgagtgtttggtttatgggtgtgtcaccatgtccagtt
catatcctaattaagaaattttttttttttggttagaaaaaaataaatcctacataggaa
ttcatactatagtattacttagagcagcagagagaatagacattcctggtatccaccatt
agaggtttctttta
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved