Cavia_porcellus Locus Mono:119:SNORA13
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:119:SNORA13
Cavia_porcellus
Mono:119:SNORA13
scaffold_205364
SNORA13
1001..1131
2131
GGTTATTTTAGGGGAGCAATTTTCTAGTAAAACACAAAGCAAATAATTACTATATTAGT
ATATACTCTGAAACATTTGAAATTAAGGAAACTTTTCCCAGAGTATTCTTTCAGATACCA
AGAATATACATTTTAGAAGTGTTCAAGAAAATCTCATGCAAATAATTTACTTTTAAAATT
GTATGCTTGCTAAAAATATCATAAATTTCACTTGATTGAAACAGCTCCTTTCCTTGTTAT
TTTAAATGAGGAAGTAAAGCACATAAAAATACCCATATATTTGTTTTTACATGTTTACAT
GTGTATGTATTATTGTATAATATTATAAGATAAAGGAAAATATCATTTAAGAGAAAAGTG
ATAAGGTTGAAATAAATATTTTTTCATGAAGTAATAATAAAATGCATTTTGCCTTCACTT
GAATTGTTAGAATAAAATTTAATAATTAGTATTTTGAAATTTAGTTTGTTATGTTTAATA
TTTTTCCTATATTTTCACATAGAAGTTCAAAAATCTGATTCTAATTCATATTATTTAACA
TATGTTCTAATGACTGTGGTAGTGGAAAAAAAATTGGAAGTTCAAATTTAACAAGTTCTT
CATTTTCTATTGGTCACTGAATTATGATACTCATTTCAAAAACCTGTCCAATTTTGCATT
GTTTGTCTGCACACTTTGGGTGTTTAGTTTAATTTTAAAATGATTTGCTCTTTGGATTGA
CCTTAGACTATCATTAATCAGTGCTCAAAATGAAGCTTATCATTAAAAACAATGGATATA
AACCTATTTTTCAAACAAACACTTTGATAATTAAAAAAAAGCTTTTTCAGAAGCTTTTTT
GAGTTTATTATTCTTAACATTGCTAGTGAACAGCCCATATTAGGCATAGAAGTGATAGTC
TTTTCACTTGTATGTGATTACTAATGTATTCTTCCATAATATATTAATGTTTTTCCTTTT
TTTTTTTACTAGAGTTAGATTAATCAAAACTTGGTACAATTAGTCTTTGTATTGCCCATT
TACTTTTAAAAACTAGTAAATACGGTGTCAAAACAGGCATAAATAAATGTCTTAATTATT
TTCCTGACCTTATATTGGATATATTTGGTGCAGGAACAGCATAGTAACAACTCATTAAAA
CACTAGGTATTATGAATTACCTAAATGGACATAGTCACAGTTTCTACAAGCAAATAAATA
AAGCATCTGTTCATCAATTGTTCCCTATTATTGTTCATAGTTATCCCATAGTATACCTTG
CAAAAATGATTTTGGTTTAAATGTGGACAGAATGAGAATACCAATATCATATTATCTTAT
ATAAGAGATCTTATAATTATCATTTACCAAAGCTTCATTCATTTTTACATTTAAAAAAAT
ATAATAGTAATTCCAGTAGTTTATTCTAATTGGTTATATAGGGAAAAATTTGAAAACCAG
TATCTAAACTAAATGAATATTCTCCTTCTGCATACAGGTTAACTCTTCATTTAGGTGCAG
TGAAGTTGATTATAGCAATATTTTACAAATTATAATGTGCTTGACTCTCAGAGATTAAAT
TCACATGACTTTCATTGAAATTTGTCTTCAAACTACTTATTCAAAAACACTTTTAGTTTT
CTCTCACTTAGAACTAGTGTGAAGCAGTTGTTTCTGTTGGCTCAGTGCACTCTGGAGGAG
GAGGAGGAACACTTAGAGCCAAGTATCTTTACAGGATGGTAGACTATAAGAGCCAATGGG
CCATCTAATCCACAGAGGCATGAGCGAATTCACCCTATGATTGGGCTGAGTCTGGGTGGG
ATCCAGCAACACCAGCCTCATGACTTCAAAGTTAACAATGAGTGGTTGTAATTCTAAATG
ACTGACTTTTTTATGTAGCATTGGATAATATTAGGCCAGTGTCTAGATTTTACCAGTTAA
ACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved