Cavia_porcellus Locus Mono:606:SNORA32
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:606:SNORA32
Cavia_porcellus
Mono:606:SNORA32
GeneScaffold_232
SNORA32
5216..5336
12365
ctgcaggtaagcccggtggcacatgggctccaagttcacaagtgactacaccatgacca
agctacatggagccagggacaggagctgaacagaactgaggtgccgcagtggacagagac
gttaggccctgggcatctgcaatgtctgtgcaccaaagggaatggacagctccagagctg
gcagtgcccactttcatgtgccgctgtggccctgcagttggaacacctgtaccccaggga
acctactggaaatgttcactccccacttctccaaaacccaccatactgcaaggcctgcat
cctgggctcagacgggccccgcaggtgacagaggctggtcagggagctgcaggcggaaga
cacagctcctctcttgtttccagcaccgccaggcccccctcagctgagggggaggagagg
tggtcccacagggaggagagaaagaccccagaaactgggaaaggagggagggagggaggg
aacatggattcctctgtctttattggacgctttatagatgtcacaaaggtatgagagtta
cactgttaaataattatttaaaaacagaccaggcccaaggcctggtctacagctccaaac
cagaagcagaaaggaatgggggcggtgggctggggggttcctccaacatcaccaaaccca
caacacaaggctctcccactccctccctggccacatccaggctccgggcccttgggccag
cctgcaggagctctcgctgtgcctctctgggggaaggaggccagtgagggctggaggggg
cggtcagcctagcccggtggacagacgtaaccaggaggcagaggaggcagacaggtactg
cccggcggtgggcagtgcagcgaggcaggctgaggcggggaggggctggggcagtagtgc
agcgatgcgggatgcagccccgggctcctgtcctgagcagctggtcaggtggtagctggc
agtccgcaggtggtgctcctgacccgagcctggccaggggcTCACACATTGTGGGTCCTC
TTTGTGAGCTGCGGTTCCTCGTCTACCAGCTTGGACTTGAGGTGTTCCTTGTAAGCCAGG
ATGTCCCCAGGCCACTTGGTGATTGCCTGCTTCTCACACACCCAGATTTCCTGAGCCACc
tgcaaatagattccgggttgagcagccagtatctgagtgtgtcccgcaagaaacagccac
gcccctttgggcttctgcccaaacctacgtccattcagtttcactgcctcatgtccattt
tttgggccatctaaccccagggcactataacctgcaggctcaggagccttctgagccagc
tgccgccctattctcagaccagggtttggactgctcacagccttcatggtcagctgcctt
tcccaccctgccttgtctcctccaaggcttcagaaacagccttcctcctaacccactcct
tcacagaggaataccagttttggactgaaagatcttgggacaataataaaagaccagttc
ttctccatctgggccaacaccgaggtgatggacatccccacagagccataagagctggtc
ctcactggccatccgtgcacagcccttgtcccagttcatctatctcaccctggctctact
cgctgccctccctggccatgtgtaaggcctcacCTGCTGGATAAGTCTGAAGTCATGGCT
GACCAGCATCATGCCGCCCTCAAACTCATTGATGGCGTCCGCCAGCGCGTCGATGGTCTC
GATGTCCAGGTGGTTGGTGGGCTCGTCCAGGAACAGCATGTGCGGGTTCTGCCAGGCCAA
CCAGGCCAGACACACTCGACACTTCTGCCCATCTGACAGGTTCCGGATGGGGCTCACcta
ggaggagccgggtggggcacaggccacctgtgtcaccctctccacttcccccagctcctc
tgtaaccatctctgggggcctgactgagacgcactgccaaatccacacctttcccccagc
actgagaccctgacgcactggggccatccatggctccctggttccagggttgagccagga
gtttgtttcctaggctgtaagttcccctgccatcaagcgctctggcacagggtatgcaaa
ggccagctccctctccctgtcctcagggtgggacagctcctgcgggtttccaggccggtg
tcccagcccaggcccttcctacctccttcactcacCTGCTGTTTCCCGGTGAGGCCATAC
CGCCCGATGATCTTCCTCATCTCCTCCTTCTCTTTGATCTCAGGGTAGCACTTCATCATG
TACTCCAAAGGCGAGAGGTCCAAATCTAACTGCTCCTGGAGATGctgcaggagaaaggac
ccacacaggtgaccaacagctggcttcagagcccacagggaggaggccagacaactctcc
acctctacccaggcacttgtgcagaattcagagaagggagtaggagccggtaaggctgtg
ccggggggcggggacgcagcccctgctgacactggacaacccctgggcccaagcctgccc
ttgacctcaggtctgtacCTGATGGTAGCGGCCTATCTTGACATGAGAATGCTTTCGGAT
CATCCCATCTGTAGGTAGCAGctagggagaataaaacagcaggtgagtcagcgtgcgaaa
aagaaaaaacccactgcaccccgaacaaggctcacacaacttcgccaagttaggctgtta
ttctggtcactctaaaaatatctaggaaggtaggtttagtggcacagacctttaactcca
gctacttggaggctgaggcaagaggatcacaagtttgaggtcagcatagcaacagctttc
tcttaaaatgctggggatatagctcagtggtatagtacctctgggttaattcctagtaca
tcttctcaccccccccaaaatttagaatcgtatactgaaactggctttgtcaaggcagac
aaaacatgtaatttattaaggagttatgacctgtctgctagaatgtactacactgagtta
caaggcacctggatgtaaacataatcagaggtttgctgaacagaaatgcacctctgctct
tacagatgtttccatgccctgaacactggaaacagcagacatgagacagactcgtgtatt
cacatgcacgctgttacccagactttcctgcctccactcctgcaaggctgccactttctc
tcttcctgaggcaacacaggtgccatgacaccagccctgtccactgcagcaccctacCTC
TCCAGTTAGCAGCTTCAGAAGAGTCGACTTCCCTGCTCCGTTGGGCCCCACAAGAGCCAC
TCTTGTGTCGAGGTCAATACCGAATTCTAGATTATTGTAGATGCAAGGctgagggggttc
aagagaaacacagacacacgttggccatggctctaccctgcctgccatccaaccacgtgg
agtctagggtgccaaaggggcagatgggagggaaggaaggactcagagctgtgcccgagc
ctgaacccacctcccacccagctgagcattttcctcctgtgcaactccttcaaaggccag
cgcaagtcccagataggccgcactgctggcttccagaaatcctgcccacagcccccaaac
acaccctgcctcacaggcacatgcgggcgctcattcgcagccctggcccgaactcacCCC
GTCCTTTGTGTACTTAAAGCTCACATTCTGCACCATAATGACAGGTGGGGGGATCTTGCC
ACATGGTGGGAAATAAAATGACAGCGTctgggaagggagggaggccatttatctatcagc
cgggtgccatttttaacccctgtacccccagccacctaaccgatctcgtcagtcctacCT
TGTCACTCACGACCCTCTCCGTCAGCCCCGAGGCCATCATCTTCTGTAGCGTCTTCTCCT
TGCTCTGGGCCTGCCGGGCCAGCTTGGCACTGCCATGACCAAACCTAGCAATGTAATTct
gcaagagaccagggaagggcctggagcatgcgcagacaccaggtaacatctcttcattcc
ggggtgaccaatgaggactccggctttttcctccatctctccggctccttatgcacattc
ctgtaagctcctccaactctcccgcctctttcagggggaggacgtgggtttggccccctc
atctccctacCTTCATATGTGCGATCTGGTCCTGCTCCCAGTGAAACCTCTTCATCTGGT
TCTCCTCCAGCTCCAGCCGTGTCTTCACATACTGGTCGTAGTTACCctgcagggaaatgc
accagccaagcagacagtgttaactcaacctcagtgtaggtacccactccgagcagagtg
ggtgcagggcaacgtggacttggccttggctagaaggctgtgcagcaggcaaagtgtatt
gcagaagcacatcctaatgcagagtgtgagatctttcctgtctggtagcttggggcagcc
tcagctacattgtgagttcaaagccagcctgagctacacagtgagacctgatctcaaaca
tccaaaaataaagagctgggcatttagctcaatggcataatcacctgcctggcaagctca
aggttctgagttcgatcccagtgccaaaaaataaaaaataaataaaacaaaagcaaacta
tagaagggagggagggaaagaattaagatgtgttatgcacaggtatcaactccccgtgat
gagtgtaatcatttaaagcagtgctgaaaatcaactctcagagcagaatgactactaata
ttacagttatgaagaaggactgtatgtgtacatgaaatgtcctacaaatgcttgcaagca
tgcaaggaattttcgcaacactcccaacagtgaatacggctgtgagtgaaaaggactttt
tacactgtatatattttattaaatagtgaaattacaaggtaagatacagtaggcaagctg
ctgggcccctgaactcaagtctgccatgcccagggagacactgcccgtggcacaactcaa
gagaccgaacaggtgccacatgagaaggcagaggatcaggcccatctctggggaacagag
aaggcaacttctttgccataaggcaaatgcacaccacatgcagtggccgccaacccaagg
ttatggcctgaaagcaatggctttgggacaaaaataaaacaggactcctgggccacgtct
ttttatagcaatggggagaaaagagctgctatactctggttaaaaggagaactctgtggt
cactacccaggcttttagaatgaagcttctaatttgctgtggacatgaccataaaaaaat
tccccactagggtttctgtctgctacctcgttagcaatcaacctgttgggaccattacat
ggccgaggtgaacgctgtccaatactatttacaacagccacatttaaaattcttactctc
actacaaggctagatctctgcaggctggctctagaactcaccaacgactgtataaccact
tttatattcttctgcagggcgtctggaatgactagggtaagcatcaaattcctttagaaa
gggctatcttgaggacatcttgttaggtcatcttatggatattaatgaaatcacatatga
aatttcttaaataaaagtttcattcattagaaaaacaaagaactccggagcaggctgagt
gtggcatggtgtagggaaagcagagcccactcacCGTGTAATACTTCAGTTTCTTGTTGT
GCATGTGGATGATATTGGTGCAGACTCCATTCAGGAAATCTTGGGAATGGGACACAAGGA
CCAGGATGCGCTTGAAActgcaaagccaagaaccagtcaggaaggtgctcaaaacccgag
ctggctgggatgggcaagccgagccgggccagaacatttcatccttccccgccttcatca
aagcaccctacaaatgcactatgcaactcccaccacgcgcccttatcagtaaggaagccc
ggtgccctttggagaacaagggggcggccgactccctggtctcctggtccagaggtcaac
agaggaggaggaggagacggagatggcaggaacactcatggcaaggagtacgtgtataca
agtccacactaagtgtggccagaactgtgctgggcaactggactaaatgcaatacaaaaa
tgaggtttttcttttaaaagagataccaagtcactaaaccaagggcaggcatggtggctc
atgcctctaatcccagcacttggaaggctgaggctggaggatcattgtgagttcaacacc
agcctgggctacaaagtgagctcaaggcagcctgaactgcataaagaccctgtcttcaaa
aagacaaaaaacaaaaacaaaaaaaacaagtcactaaatcacacaaagctttcttttaaa
tctggggcaatgttctgggttactcagttctttaactgaaaagatcatgcccaatttggc
ctcctgtcatctatcatcacctcaggggaaaagccccttttacataatgtacacataatc
aagaaaagaaatacaggctttagtcaagatgctgtatttcaaatagagagaaacccaaaa
agctttgtttaaaaaaaagctcatcttctttgaactaaatgaagacgaagagaccagcag
acctcagcactcagcggcccgctgcccactttcttatggctcctctatcacccgtgcagc
cctcagcaccactgtcttggtgctctgtggaccccactctcccccacagcagcccctccg
tctccctatccttacGTCTTCAGTTCCTCTTCCAACCACACGCAAGCATCAAGGTCCAGG
TGATTGGTGGGCTCATCCAGGAGCAGCATGAAGGGCCTGATAAAGAGGGCCctggaggac
aggaggaaaggacctcagtatcccggacactacgcggaggggactagcttgcccaccatt
ggcacttctctcagacctggggggcctgagtcctggaatcaacctgggctctaggtatca
gagaaaagggaaatcttgggcagaaagcaaagctgaagagctgagatgaggggcaagagc
agggtttggaggcgcacaggaatgtggtctagcctggcatagtggcacagggctgtcagc
caagcactcaggaggcccagtactgttgcaagttcagggctacacaacgagtttgagacc
agcctgaactaccaagtgagactctgtctcaaaaaatcataaagaatgcggtctggagat
gaggctgcaaagttaagagtctatgagccttgtgcactgtggttagtgtccaggaggaag
gcaggacacagagggaataaactgctactgcaaagagtgtcacagtcacattgatctggt
ggagctgccatgtgctggtgggcaccaagaggtagaaatgtaatccagcaatggagttta
cacagggagctttgggaagtgaccaggattagataaggtcaccgtagtacagccccaaga
gtgaatgctggtggctttaaaagtgggggggaggggacaatagggtgctgcacctcctca
agactgccagcaggagcctctagaaccatgagtcaccgccacataccctgggtatttcat
tacagcagagggaaacagacaaatacagctaggagcctctcccaagattcctaacccgga
atccaatactgggtccctctggaccaccacagccaggaagctcctccagcccacagtgac
agcccatccatgccggtgtctcatacgacactttctgactgctgacccctgctccaaaca
gtcccacaggggtaagcactcaactgagagaggcggagagctgcaggggtcaggaaggag
gtaaggacttacCTGGCAAGGGCGACCCTCATCCTCCAGCCCCCGCTGAAGTCTTTCAGC
TTCTTGTGCTGCATGGCAGGAGTGAATCCCAAGCCATGCAAGATCCTCGAGGCTCTCATC
TCCGCCTTGTCAGCATCCAGCTCCTCCAGGCGCTCGTAGAGCTCCATGAGCTTCTCACAC
TCCGctgtgggcagcacaaggccatcagccttcctggacctggctcggaaggcagcctac
ccccacccgcctccaggcctacagccctacCATCCTCGTGAGCCAGACGCTCAGCCTCCT
TCTCCAGCATGGCCCGCTCTGTGTCCACTTCCATCACACACTGCAAGGGTGTCTTGTCGC
TCGGGGGCATCTCTCGAGTCAGGTGGTAGATGTCGATGTGCTCAGGGATGGGCACTTCCC
GCTTCCCAATAGCAGAGAGCAGCATGGACTTCCctgagggagacagaagacacctgcact
tccccaccgctcctctctgcggctcttcccagccaaagccattctttgtaccttcactcc
ctttcctggtccacatccttctgccctccttccttggaatccctgtccaactttcctcaa
attctgtttttgctttttttttttttttaatttttttaaagacagggtctcactttgtgg
tgcaggctggtcttgaactcactctgcagcccaggctggcttcgaactcatggcagcctt
ctcctcggcctgccaagcgctgggattacaggtgagtgcaatcatacctggctttcaaaa
ttcttgttctctgctatgaaaacgttttcatttacagcaggttcccacagcaccgcgcct
ctgctcccaccaacctctccagcactgcctgtctaaaacactcatgtggcaacaccatgg
ttagtcccctttccctgggaatgtctggtctcctacatgtaacgtgaactggttttgtac
acagctagtgctaaatactcactgaaggacagatggccaaaaaagagggacttccccctt
gccttctagagcctcacCGATTCCATTTAAGCCAATGAGGCCGTAACGACGGCCCGAGTT
CAATTCCAGTTTGGTGTCACTGAGCAGCTCCTGACCGTGGAAAGTGAGCGACAGGTTGAT
AATGTGGACATCAGTACTGTTGGGGTGGGAGGCCAGGACACCAGTAACGGCTCGAGCAGC
AGCTTTCTTCATCTCAAAGTCCTCCAGCTCCTTGGTCAGCAAATCTACTTctgcagacaa
aaacatcatgaggggaggggggcagagagagagaagactcagctctcatgtgaacggcca
gaccctagtctccgaggagctgaggtcagttcaccctgggcagatgcgcggtgtcatggg
cttcacacaccgccctctgtgtagcccatcttgagctctggcttaactcctgtgtccttg
ttcacactcagcattcttaacaactctctatcctttttccctctggccagcaacaaaatg
tccccatggcctgactttacttggttttggacatggaagcctggatcatgtacagactag
gcatgctctctcccctagaattcttattgtggagacaatttctaccactcaactctctgg
tagtaagcatttttttaaactgttcttttttcatggtcccatgtgttattaatttgttac
caatttcctttttttcttcaaacatttacttagtatctatttgtagtacagacgacaata
aaagaactacatagcacattaggaaggaactacatagcacattaggaggctgagacagga
gaatggaacatctgagcacagctgggtaactttactatgtagcaagactgtctcaaaata
aaaagtctaaaacaagctggaaatgtaactcagtgtaaagggcctcggttcaagccctag
tacagagtgagacagagaggcagagacagagagacagagaattactgaaaacatggtctc
tactcaaagagaaaacaatgtacatgaataaaaaaaagacaaaagaaggtaagtaacact
aacacaacagagtatggtgaactggaatattcctaaggccgtctgcctggaagaagcttt
cctatcttcatctgtgctttagtagaactgtcaaacatacactgtgctattaaaactcag
tgtgtatccggggctggggataagcacctgccttgcaagcagtcagtggtgagttcgatc
cccggtaccgatgaaaaggaaaaaaacaaacaaacaaacaaaaaaaaccctcagtgtgta
tgaaaggacagaaatgtaattcaaggggcagtgaatagtcgagatcagtggtgggggacc
taaggcacacatgctacagcgagtgggctgtttgtaccactgaaagctctgcttcactgg
tctagatggaggactgtgtggagacttcttaagagcagaaaagaggctagattagactga
aatggaatcttctgcccacactatcacatttcctcatccatattataaattatcagagca
gactgtctttatagtacctagtgtctagcacttaaaaaatgttcaaggtgggtatggtgt
aatctcagtactgtaacctgtaaacaatctcacctgtaatctcagcactcaggaagctga
ggcaggaggatctttgttttcttttgggtttttttggtaccgaggattgaactctcagcc
tcatacttgccaggcaggcacttaagccactgagctaaatcctcagccccagcaggaata
tccttctaaattagagaccaacttggactacaaagtgagctcaaggccagcctgaactgc
atagggcctcaaaaagagaaaagaaagaaagaaatgttcgataaatatttcccaaaccag
gggttgtggggcacacctgtaatcccagcatgggggagactgaggcagctggatcacaac
aagctcaaggccaacctgggctacacagtgagttcaaaccaggctgaaatacttaacaag
agactttgcctcaaaaacaaacaaaaaaaaaatcacaaaatataagtcacagaaatgcag
ctgttccccaaggaaatgccataaaacagtttgttactataatcattaccctatgacaag
aatatagcaagaacctggcacactccccaggtgtaggaatgaaattaaacagcgccagga
aactgccttgccctgcagtaacccaagaaagcagctcaacaaagcccaggtctgcctgcc
actcaggccagtttccttgatcaggaaaagggaggcacacgttccaactctaagggttgg
gttcctcatgaaagagctcaggggccctgggcacatcctcgcggccccacaaccagattc
ccacactcagcaaacaacccaggtgctccccgccccctcagttcacCTGTGGTCTCTCTG
CCATTGGCCTCCTGGTTCTTCTCCTCCGCCACCTGCGGTTCTGTGACAGCATCTCCGTTT
TCTTCATGTCCCTTTCTGGGCCGCTGTCGGGCTTTGGCAGCTTCCTTCTTCTTGGCTGCC
TTCTTCTTGGCCAGGTCGGAGGGCATggtgctgacccacaggggcactcagtgttcttcc
agggagtctgaaggaaggcaaacagatgctccactctgctgcatttactgctctagaggg
cggagccaggctccatccctcctgttttcccatccagccacggatgcccgctctgccaac
tttgccaggatgtctcccgccaaccgcgggtctcagtcgctctcttcatagcaggatctc
ttctcccaggcctcgtccacccatgcccagggctgccgcacgctgagacgctcccgatac
caggccctcaggtgggaaccaggttttctgcccctcggctgatagcccctctccggtttc
tctgcaacttggcgctccgcacttcagccgccgccccactttccgggtttcctcctggtc
gtcccaagcctcctctccgctggccctgcacaccctctaggagtcgagcccagctcctcc
ccggacgcatgcgacctccccctcgaggtccccactctcgccaccctgagcctccccctc
atcctgcgcctcagtttccctccctggccttttctttcccctagcagcactctccatccc
aatcctgcccctccttcctcttctcgtctacctccccctcaccggccagcaatccccagc
tcccgccccagccgccggcccccctagcccccaactcacccggcctcgctgctccgcctc
tgtcgcaacagagctactccttgagctccaccgcgtgcggccggctcaccagccaatcac
gacctttggcgattctgtgcgcatcgccgcgatgacttctgggaattgtagtctttaagt
ggtgttaacaaaaggcaggactctcctcaagaactaccacgtatcccagggcccgctcgt
gtccttctaatgtcatcataaagcgcgagaattaagttggggggaaactagacatcagag
tccaagagtcctctgccagcgggtctgcttcaggccctagaaactgcaaatcccagattg
ctcctc
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved