Cavia_porcellus Locus Mono:694:SNORA13
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:694:SNORA13
Cavia_porcellus
Mono:694:SNORA13
GeneScaffold_764
SNORA13
1001..1133
2133
CCGCCATAAGATCTGCAGGTCTCGGGTGCAAGCTGTCCCTTCAGCCCTAGTGCTGCGGT
GAGAAGGCACGGGCGGCCGAGCTGAGCAGAAATGCAAGAAATAAACCTTTTGGGGAGGTA
AGGTAGGAGGATTGAGTTCGAGGTCAGCTTGGTCCACATGGTGAGACCACATCGCAAAAC
AAACAAATATTAAACCTTCCCAAGGAGATGTTTGGGCTGTTTGTAACAGCAACCACTAAT
GCAGTGCTGGCCAGGAAAGCTGGGAGTCCTTGCATCTGGTCTCACTGCAGACGTCGAAAC
CGTTTTCAGATCCTTCCCTCAGAGACATACGTTTCCTCTGCTTCTCAGCCAGGATACCAC
CCTACTTGTAATTTTTTTTTTTTAATTAGCTTTTTTTGGGTCTTTTTTTTTAGACAGGGT
CTCGCTATGCAGTTCAGGCTGGCCTTAAGCTCACTTTGTAGCCCAGGCTGGTCTTGAACT
CGCAACGATCCTCCTGCCTCAGCCTCCTGAGTGCTGGGGTTATACATGTGCACCACCATG
TCTACGTATTTCTTCCCAGGAACTTCTAGAGGTCCAAGCTGCATCCTAGAAATCCTGTGT
AGCTTTCCACCTGTGCTGGAGACACACCTTTGAGCCACTGGCTCTCAAGTTCCCTCCTTC
AGGAGTGCCATGCCTACCTTCTGAAGTCCTTTTTTGGGGGCACTGCCCCAGGAACTGCAG
GAGGTGGTGCTTTCTTGGGAAGCAGCATTATTCCACATGTCCCCCTCTTCATCCTCCCAC
TGGCTGGTGCCTGGGTTCATTTCATCCCCACCACTGCCCCAGCCTTCTTGCATAGATTTG
GAAGCTAAAAAGAGAGCAAACAGAAACTCAGCCAACTTACCATCCTTAAAGTACAGAATG
CTTCACTGTAACATTTACAATGTAGGGTGCATGGGGAAAAATGGGTGTGGCATAATTTAC
CTCATTACTTTCCTTTCTCTGGACATAAAAATTGAATTTCCAGCCTTTGTGGTGCCCATT
CACTTTTGAAAGCTAGTGAATGTGGTGTCAAAAAAGGCATAAATAAAAGCTTTGTAGCTT
TTTCCTGCCCTTATATTTGGTATATTTGGTGTAGGAGCTACACAAGTAACAGTTTATGAA
AAAAAAAAAAAAAAAAGAATTGAATTTCTTCTACTAGACATATACAAAGTATATGTGTAC
ATTTTTTTTCTTCACACTCCGTATGTTTATTGCTATTTCAAATTTCTTAGCCAGATCTAA
AGATCAATCTGAAACCTAGGCATTCCTTTTTTTTTGGAGAGTTAGGGTCTCACTATGCAG
TTTAGGCTGGCCTTGAACTCACTATGTAGCCCATGCTGGCCTCCATCTCTTGGCGATCCT
CCTGTCTCAGCCTCCCAAGTACTGGAATTACAGACATGTGCCACTATGCCTGGCAAAACC
TAGGCATTCTACAACACATAATTCTTGTGTGCCAAGAATGAAATGAAATGAAAAAGCCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved