Cavia_porcellus Locus Mono:61:SNORD35
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:61:SNORD35
Cavia_porcellus
Mono:61:SNORD35
scaffold_1
SNORD35
1001..1088
2088
CTCAACAGCTGTTCAAAATATTAGAAGACAGATTAATGACACGTCAGATTTTGAAATTC
TCTAGATCATCTCCTTAGCTACTTTATGGAAAACATCTATTGGCTCCTCCTGGTGGAAAA
CCTTGTTGGCTATATTCATAATTGTCCTGCTGATTTTATTACTTAGTCCATGCCTACTTA
ACTTTCTGTGGCCGTATCTCTTCCAGACTTTAAGTTGTGTGTTTGCCCAAGAACAGCTGG
TGTCTATAGAAGGCATTTAGATAGACCCTCCATGTATCTCTGACTGCCGATCACAACCAC
AGTTCTTTTCAGCTGAACATAGTCAGACTGGTCCTTGACGCTTACCTCCTCATGGCAGTT
AAGGGTACTTCTTCACAGGGAGGAGTTCTATAGATAGGTAAGTTACGTAGAAATATTTTA
GGCAGTGACACACAGCTGAGCCCTTAAGAGGTCAATGAAGAAGACAACTGTGGCTGGGGC
ATATTCACTGAAGGCCAGACTTCAAGAAAAAGAAGAATTACTCACCCATGTACTTCCCCT
AGGAATGAACAGCGTGTCATGGTTTATGTCAGTGGTTCTCAAGCCTCATGCATTTGCATT
GTGCATTTGTGACTGGTTCATGGTCTAGTGCTTGGATTGATGGTGTCAGTGCTACACCCA
CCAAGGGATGGAGTCCGCATACGAGATAATGGCAGGAAGAAGGTGTATCTCTCTTGTGGG
TGTCCGTCTTGCTGTTATAGTTGCCATGAACTATGCATGCCACCCTGCCTTGGAGCCAAC
TGAGTCTGGACTGAAACCTCCACAAACTGTAAGAAATAAACCTTTCCTTTCCCAACTTTG
GGCATCAGGTATTTTGTCTCAGCGACGAGTAAAAAGTAACTTAGACAAGTAGTGACTGAT
ATTCTTTTTTTTAATCAAACATTTTTCCTTTTTTATTGTTATTTCCTTTGCTCCAGCACA
AATTAGGAAGTATTCAGTTATTTTTCAATAATTTTATGACAGGCAGATGATGTTTATTCT
CACAAGGGTCTTTAGAAGTCCACCCCAGGCATGGCTCAGAAAGCTGGCTGGCAACACTGA
TGCCAGAAACAGGGTTTGGAGACCCATGCTCAGCTGATTCTGATTTCCAGTATGCCCTGG
CTCCCCAGAACCCCTTTTCCAACAAGGCCTGAGTGACCTTGATCTGCTGTCCCCCCCCCC
CTCCCCGGAGTGGTGACCAAGATGAAAATGCAGGGGACCATTGTCATCCACTGATGCTGT
TCACTACAGCCACAAATACAATCCACTTTGAGAAATGCCACAAGAATATGTCCATGCACC
TGTCCCCCTGCTTCAGGGACGTTCAGATCAGTGACATTGTGGGTGAGTGCAGGCCACTGA
GCAAGACAATACACTTCCACACACTTAAGGTCACCAGGGATGCCTACACCAAGAAGCAGT
TCCAGAAGTTCTGATGTCACCTGGCTGTACCCCAAAGGGAATAAAGCTATTCTGGCTCTC
ACAGAAATCATCATAATAATAATTTTATGACATTAATTTCCTATTGTTTTATTTTATAAC
AGGTTAAATAAGACTAATTCTTAATGTGACTGATATTCTAAGTAGGTGTCAATCACCTTG
GGCTGGAGACCAAATCTCCTTAGCCCACCCCTTCCAGGAAAGTCCTTGTCTGCCCATAAG
TGCTTTCTATGTGACTTGTTTCCACATTTAATTCCCATTTAATCAATATTACCCTAGCAA
CCATATTTGTTATACATTTATTGGTTGGCTGTAGTTTTGTCCCACCTCATACTCATCCTA
TGATTTGCCATTGCATCAATATTACCTAAGTGATTATATTTAAACTCCTATTGATTGACT
GTAGTTCTGTCTCACCTTAAGCCAGCCTCTGAGAGGCTCATGGCTTTGCTCAGTAAAACA
CCCTTGAGAAGTGAAGTTAGTGGGCAACCCACTTTCCAGGGCCCCTTTAGTCCCTCTCAA
ACAGAAACATTTTTCTCTCAAATTCTTTCTACTCTTAAATAAAGATCCATCAATAATAGT
GCACTGCATTGTTGTATACAGAAATTTCTGCACTTTTCTCAAAGGTTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved