Cavia_porcellus Locus Mono:68:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:68:SNORA2
Cavia_porcellus
Mono:68:SNORA2
scaffold_217614
SNORA2
1001..1133
1321
ATTTCATAATAACCAGCTGATGCGTTCTTCTGAAAGGAGATAATGGCCTGGGGATGTAG
AGCAAATGCTTAGTGTGCTCATGGCCCTCGGCTTAACACACCACACACACACTGAAAGAG
AGAGAGAGGGAGAGACAATGATGTCACATTTGTACAGTTATTTAACACTGCCCTGGAAGT
TCACACCGAAGCAATAAAATATAAAACAAAACAAAACCATCTGCACTATATGCAGAAATA
CAAAGGAGGCTTCCCAGAACAGTAACAATAATCACAGGAAACCACAGAAAAGCATGTGTT
TATGGAGAATCGACTGTGCACTTAGCCTGGTTCTTCAAAAAGTGGGGTGTGTAAGATGAC
TCAGTTATGAAGTGTGATTTCAGGGTTTCCACCCCAGGCACACCCGCCTCTTCCGTGGTG
TCCACTTGCCAGGGCTCCTAGTGAGTCTCCCTGTAAACCTTACTGGTAGCTGTAAACACA
ACTGAGAGATCCGTGATTCTCTTTCCTTCTGATTGCACCTGTGGTCCCAAACTGGTCCAA
ACTGGTCCTGGTGGCTAACAGGAGTGACTGCATTGGTTTTTGGAGAAGGCTATTTGCTAG
CCAGAAGTCAAGAGCTGTAGGAAATGCAGACTCTAAAAAAGCTGCGACCTTTGGCCAACT
TTCCTGGCCGCTCTGCTTAAGTTTTGGCTTCACTTCCAGCTGAACAAGATTTGGGGAACT
GACACAGGGAAATGAGAAGGAAGAGAAAGTCAACTTTAGATTTTGAGCCAGTGGTTTACT
TGTTTTCCTTACATACAAAAAACAAAAGATAGAACCGAGGAAGCAAGACAGGAAATGAAA
CAACTTTAGTAGAACAAGCAAAGAAGATACGAATGACTACTTTTCAAACTGGTGATTGCC
ACAGAACATGAAACAAAACCATTTCTAAGACTTTTCATCAATGAAGGCTACCAACACCTT
TTCTTTCTTAAATTTTAATTTTTTAAAAGTCCATGCAGGGCCTGGCCCTGAATCAAGGCT
GGCAGCTTCCTGACGCTGTTGATTTCAAGCAGGAGCCTAATGAGATGTCTTTTTATGGTG
TGTTGGCCATTTCAGAACTTGGGCAGTGAAATGGTCAATTCATTAGAAACAGCTTGAAGC
AAGCTCTCACTCCTACCCGAGTGCTGCGAGTATGGCAGGCTACACCTGCCAGGACGGAGC
ACAGCATTACTGGACCACGCATGCTGGACTTGAGCTCAGAACTGCACTCTCCACTCGTGT
TGTTGTTGACTTCATATACATGAAGTATGCTCAGCTATTGAGAGACGAGACTCTATGACA
GC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved