Cavia_porcellus Locus Mono:504:SNORA11
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:504:SNORA11
Cavia_porcellus
Mono:504:SNORA11
scaffold_256106
SNORA11
1001..1129
2129
AATATAAGAACAAACTTTGATTAAAAGTAACTCCACTCCAGCAATTTGACTTTCTTAAA
AATAACTCTGGGAAGAGGAATATTGGACTAAACACAGTTGACAAGATAAAAGCTAGCTAG
TGTGTATTTCATGTTATTCTAGAAATGTAAAATTGAATAGAAATCAAGAATTTTAAAAGT
ATTTTTGTAAGATTTATCAGATCTCATAGTCTCAGCTGCTGAGGCCATTTCAGGTGCAGG
CAGTATTCTAGTCTGAGGCAGGGCTGTGCACTTTGTCTTGCTCAGCCACCAGCACTTAGC
TGACTCTAGTTTCACTGGGACCCACTATGTCTCTCTCTGAACAGTGGTCCCTGCTTCCTG
GACCAGGAAGATTTCTTTAAGGGATATTTCAGTCTGCGAGCCTCATTTCCCAGATAATGA
ACTACTGAACCTGCTGGTAGAGTTGGTAGGTGTCCAGCCCAGCCACCCCAGCACTTCCTT
TCCCTACAGGACTCTGTGTGATTCTCGCAGTAGACCTGCACTACAGGTCTACATCTACAG
GCCTGCCCTGTGACAGAGCTGGGATCCATCAGACGCTTTTCTTCTTACTCTAGCTACTCT
GACTTTTTTCTGTGTCTTTTTAAAACTTTAGTTTACTACTTTCTCTCCTTGCCACTCGAT
GTTGTCAGGTGTCTTCTGATCATGCCGATGCCTCAGAGCCTCTCTCAGTGTTCACACTAT
AGTCTTCAGTGATGAATCTCTCTGTAAGTCATCTTTTAAATAATTGTCTCATTCAATCAC
GAGGTAAAGACATTTTAAAATATCAGAATTCAGAGAGAAGATAAAGTGTTCAGCAGGAGT
AAAATAGATCCAATCTATTAATTATAAATTTTATTTAAAAAAGAAAATAACTAAATTTAA
AATTAAAATGTAAATTTAGGGTTTAAACTCAAAACTTAGGTGCTTAGAATATTTTATCAA
AAAATTGCATAACAAAAATAATGAAAGAACACTTCTACAGTGGGATGTGCTCAGAGCAGG
TGGCCTGAAGAATGGCTTCTCTGTTTACAACACACCCAACAAGAATCTAGGCTCATTGGG
ACAAGTAGCACAGAACTTGTGACTTCCTTTTAAGTGAATGTCCTACACATGTGCTCCATA
CACTTCCCATTGGCTACTACCCCATTGGTACTATCTAGATAGTAGTACCAATGGAACGAG
GCTCAGTAATAAGGGAAATCTTTAGCATTAAGTGAGGGAGTTGGACATTTTGATTTTGTC
CAGTGTATTTGTGGAGATCTCTTGGTAGTCTTAGGAGTAAAGACTTTGAATTTCTATTTT
TAACAAAATTCAAAAAAATTTAAAAATACTTTTATAGTATTTTTATAGTATAGATAGTAT
TTTTTATAGCATAGTTAGGAAAAGTAGTGGAGCAGAATCTTCCCTGAATAGAAGAAAATG
TGAAAATAGCTATAAAAATCTGATAAAATAATTAGAGTTCTAAATATACAAAAGTTTAGA
TTCAACATCTAAATAACTTCAAGGCCTACCTTCAAAATGGGAACTGCATCAGATAAAAGT
TTTTTTGAAAAAAATTTAAACACAGAAAAGACAGAATTTAAAAATAAAATTATGAACACA
TAACTTTGTAAACAATTCCTTACAATTTCCAAGACATGGTAGAAAACATCCTAGAATGAG
ATGCATTGCAAGAAATATCATGTTACTATTTCATGAGTAAGTTTCAGAAAATAAAAAATC
CAAACATATTATATAACCACATAAAAGTAGATTAGCAAAAAAAAAACATGAATTAAGATA
TTCATGTGAAAACATAACGTATCACTAGTAAACAGCAAATTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved