Cavia_porcellus Locus Mono:465:SNORA79
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:465:SNORA79
Cavia_porcellus
Mono:465:SNORA79
scaffold_125
SNORA79
1001..1144
2144
AAAAAAAAAAGTGGAGGCCCTTTCTCTGTCTTCCTCACACTTGGGCAGACCCAGTGTGC
CGCCATTGTGAGGTGTTTCAGCTCTTGAATTTTGTCCATGTAAAAAGTCACTGTGAGTGG
TGGGAATGCGTGCTGTGTGAAACACCACACCGCCCCGGCGATCTTCAGTGAGTAGGCACC
AGAGTGGATAGCAGTGTTATTCTTTGTGTGGTCAGCATTTTAGTGTTCTCTAATATATAT
TTGAGCCTTTAAAAATTCAAGCACATGTTTTCCTTTGTTCTGTTCTAGACAGTGTCTATT
GAGAGACTGGAAAGCTATTAGTTTTCCTCTTGGCATTTTGGGGGGCAATGTGACTATTTT
GTTCTTGTTTTATGTAGGGAAATCTGTGCTGAATTGGAAACTGTTATTTATATTTTATTG
CAAACATTGGTGACTTTATTTTTCCCTATTACTTTTCAGTTGTCACCTTTGAAATTTTAT
CTGATGACTATTCAAAGGTATGTTGGACAGTATTGGTTTCTCCTGACTATGTCCAAGCAA
TGAGTGTGTGGAATTTATTTTTAGATGAGAATTTTTATTTTCTATTCCACTGTTAGCATA
AAAATGTCTGTGCAGTAGTGTATAACCTATCATTTTCTGTTACGTACTTTCATTTTAATA
CATGTGTGCTGCATAGCAGTGGTGGTAAGACAAAAGCCGTTACTGTGGAGTTGCTTATTT
CTAAACTAAAACCTCAGTATTCAGGTTTCATTGAGGTGTTGGCACTTTGCAATAAGTAAG
TGGGTTTTGGTTTGAGCAGTTCTTTCTGAAATGTTCACCCACACTGCTGTGTAAGGTCTT
TACAGTACTCCTAGATGCTGGGCATGGTGGTGCACGTGTGATCCAGATTCAACCAGCCTC
GATTACGTAGCAAGACCTTGTCTCAAAAAACAAAGCAAAACAAAATTAGCAATAGTAGTA
GGGACTTTGGTCAGCACAGTGTCAAAATTGGTTGTCCGCTTTGATGACTGTTCCTCCTAT
TGCTTTGAGGTTTGGCACTAGGATTTTAAGTCATCATAAATTGAAATTTGATTTTCTTCA
CTCAGAGAATATTAGGATAATGGGATTATCTGTCTGTTCTCTGAAATTTGCGGAATCAAA
CAGTTCCATTTACGCTTAGGTGACATTGCTGTTACTTCTGATTTGTATTTTTAAAACAAA
TGATGGAAGAAGCGTGACCATAGTAATCCTCAGGTTGGAAGAAAGAGATTATGTAAATTA
AAATAGTTTTTACTCTGAGCTTACTCTTGAATAAACTAGCAACTGGTTCTAACAGTGATA
CATTGTATTACATCAGTAAAGCAGTATTGAATGAGGCAAGGTTAATTACATCTGCACTAA
CATTAAGAATGCACAGAGATGTGTGTGCTTAGATTGGGTAGCTATTTCCTGTTTCTAAAT
TCCCTTCTTTGCATTGTAATTTAAATATTTTTAGTAGTTTTTCAGTATGGAGTAGACAAC
ACAGCTATTTTGTGTAGAAATTTAAAATCTTTTGAGTTATCAAAGTTAAATATTCCAATG
CAGAGAATGTGAAAAATATATAAAAGTCAACATATATCATTTGTGTGCATATAAAATAAA
AAAATAGTTCTCATCACATGTGAAATCTAATCTATATTTTTGGTAACCAGTAGCAGTCAT
CTTTCTTAGATCCTTTTTTTTGATACACAGTCTCACTGTATATAGCCCACACTGTTTTCA
GATTTGCAATGATCCTCCTGCCTCAGCCTCCCAAGTGCTGGGATTACAGATGTACACCAC
TGCGCCCAGTTATTCACACAGAGCTTATCAAACTGTGATAATAGCAGGATCATTAAAATA
TGATGTCCAGTGACACAGGAAATTCCTTAGCACGGTCATTGTGCAGGGCTGCATGCTATA
AGATGCTGAAGCCTGAGACCTGAGCCGCCTTCGTGTGCTCTCTTCCTTTAGAAGAAAGCA
TTGAGGGCACAGGAGCCTTCAGGAGCTGAGGTAGCTCCCAGACTCCTCACCCAGGGGGGG
TGTGGGGACACACACACACACACACATACAGAGGCGAATGCAGCCCTGTCTGCTGGTTTT
GGTGGCGATGATAATCGCCTGAAAGCTGAGCAAAGCCGTTTCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved