Cavia_porcellus Locus Mono:216:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:216:SNORA70
Cavia_porcellus
Mono:216:SNORA70
scaffold_210250
SNORA70
1001..1135
2135
GCTAGTTTAGTACAGAGGACCAAAAATATAAGGTACATTCAGAAATCATGAGATTCTTC
TGATTTCATTTTTAAATACAAGAATCACACATTAAAAAGAGTGTCTTTGAGCTAGGCAAA
GTGGCACATGTCTGTAATCCTAGCTTTCTGGACGGCTATACTTGGAGGATCACAAGTCTT
GTTTTACTGATGATCTGTGAAAATTATTTTTAATTTATGATTTTTTTTTTTTTGTCTTTT
TGAGACAGGGTCTCACTATGTAGTTCAGGTTTGCCTTCAGCCCCAGCTGGTCTCGAACTT
GCAAATGGTTCTCCTGCCTCATCTCAAATATTGGGATTATAGGAATGTGCCACTAGACCC
GGCTTTAATATGATTTTGAATAAAGTCATGTTAAATATTTGACTCTATTAAAGATAACCT
TTTTTGGGACTGGGAATTTAGCTCAGCGGCATAAGCGCCTGCCTTGCAAGCAGGCAGTCG
TGAGTTCGATCCCTGGTACCGATAACGAAAAAGACAAAAAAAAAAGATAACCTTTTTCAC
TTTTGTGTGCTAAAATATATAATTTGTTTGAGGAACCCACTTTAACTTTCAAGACAATAT
GAAATTATTTAGTAATCAGTTCTTTAGTTTTTTTAAAACTTGCTTTTATCGCTACAGTAT
TTAGTTTTTTCCAGCTAACATTATTTTTGATTTCTGAAATCCATAACTCATCATAAGACA
GGAAATACTGAATTTTAAATCTTTATTTGATATTGGCATATTTTGGATTCTTCTCTAGAT
AGCTGTAGTAATACCCAAACTAATTTAGAAATTCAAAGAATAAAGAGAATTTTATATCTA
ATTCAAATTTCTCTATTTCCTTAATACTCTATTTTGATCAAAAGTCCTACTTTGAACTCA
ATGAGTTATTTCTATAATATGATTAGGTGTTTTTATAATAATTCTTTTAATCTACAAGGT
GATGTTTCCTATCAACTGCTTGTGAAGAAAAGAGGTTCTTACTGCAGTCAATTAAGCTGA
CTGGGCGCCTTTGCTGGTGGGTGCCCAGTGTGCAGTGGCTGCAGACAGCAACCTCTTCAG
TAGTGTATGCAGCCTGTTACTTACATGGGCTGCTTCAAGGGACCTTGGAGACACTGCTTC
CAATGGATGTTCACGTATCTGAACATCTGCCACCCACAATCGAGGCTCCATACTGGCATG
CCGGGTGGTTTGGGGAAGCCCCAGGGCACAGTGGCAAGGGTTCACATTGGACAGTTCATC
ATGTCTCTCCCTACTAAGCTGCAGCATGTAATCGAGGCCCTGCGCAGGCCTAAGTTCAAG
TTTCCTGGGTGCCCAAAGATTCACACCTCCAGAAGTGAGGCTTCACCAAGTTCAATGCAG
ATGAATTTGAAGACATGATGGCCGAGAAGCGCCTCATACCTGATGTCTGCGGGGTGAAAT
ACATACCGAATCGAGGTCCCCTGGACAAGTGGTGGGCCTTGTACTTCCACTGCTCTACTT
CTCCCATCGCAAGCTCATCAATAAATCTCTGCCCTAAAAAAAAAAAAGAGAAGGTTCTTT
TGATGTCAATTTGAGATTTTTATTTTATCATTTTTTTTTTTTTTTGGAGACAGATTCTCA
CTGTGTAAGTTCAGCTGACTTGGAACTCAGGTGTATAACCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved