Cavia_porcellus Locus Mono:63:SNORA31
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:63:SNORA31
Cavia_porcellus
Mono:63:SNORA31
scaffold_155158
SNORA31
1001..1126
2079
GCGAGGGGGAGAGAGAGAGAAACAGAAAGAGTAACAGTGACTGAGGAGTCCTGCTACAG
GCTAGAATGTGTGTGACCTTCCGGGCCTGACTTTAGGCCATGAGCTGTGCCCATGGCTTT
GCCCAGCAGGCCTCAGGGGAAAGTGCCTCCCCCATCTAGGATTCTCCCTTAGCCAGTGCA
CTGCAATGGCTGGGGTCAGGTGGATAAAGCCGAGGGCTAACACAGCCCTTGCCCCTCCAG
GATAACTCTGCATGTCTTCGTTTACACTCTGGGCTACTCAGTGGGAGGCCTCCATTCTGT
CTGTATTCTCAGACCACAGCTTCTCCGGAGGCTTTAGCTGAGGCCCTGAACCAGTGCTTT
TCCCTCTCCTTTCTCCTGGCCCTACTGGCTCTACAAAAATCTTTTTATTCCCACTGGTCT
GCAGTTATGCGATTCTTGTATCTGTGTTGCTTGCTACCCAACTCCCACCATTGCTGTGCT
GTGGGGAAACACTGGGGAACCAGCACCTTCTTTTTGGCCTTTCGCTTCTTCTCCTGCAGT
AAGTGAAAAAAGGCCTCAAGGTTCCTGCCTGTACAGCTCATCATTTCCAAGGACCATCTC
CACACCGGAAAGCTTGACAGCATCTGCAAACAAAAATTAATTTCTACATACACTCCGAGA
CCTAGGGAAGGAGACCTGAAGGCTACTGGAGTACAAAAAAATGTGGGATGGTCAATAGTT
GCCACCCACAGTGTGTATATGAATGTACTGGAACATGTCTGACACCCCTGATACTCAGGA
CCTGGGATTCAGGGTTGGCCCAGGCTGACTTGGAACCCTGAACCTCCTCTTGCATTTTCG
TATGCACAAAAATCTACTTCAAAATACTGAGTGCCCATTTTCTTCCTTCTCTTTATGTTC
CAACTTACAGGTTCAGAAGTATATAGGAATTAACATGGTATGCGTATCAGTCACACTGCA
CACTAAAAATCCTATTTCTGTACTCTGAACTTGTTTACATACTGCATCCACTGACAGACC
TTGAAAAATTTGTTGTTCTTTTGGTTTGCACTAGGATGCTAAAGGAAAAATCCCTGTGCT
TTCTGTCTGTCTTTATGGCATCCCAGATTGAACTGGGGAGTACACCTGTATAGTATAGAA
GTGCTCTTAATTGCACGAAATGTTAATGTAATTTTTCTTGTTTCTACAGTAATGGATTTG
GTGGTTACCTTGGATCTATCACTTGTCATAACTGGCTGCTGCCTGTCATGCACACAACAC
AGGCTTTTAAACAAATGGGAATGATACCTTGAGTGCTTCATTTATTTTGACCGTGATTTA
TTTGGAATGGAGGCATTATTTTTTAGGGAAAAACACATGTCGTGTAGGTTGTCTAAAAAT
AAACTGTATTTAAACTCATTTGAGAGAATGCCTCTTCGTTTAATACATGTATAAATTAAG
TCCACTGTAGTGTTTGTGGAGAAGATAGAGCCTGGTCACAGATCACTGCTAAAAAGCATA
AGACTGTCCTCAAATAACGTCTGCAGTGGAAACTACTTCTGAGACTGGAACCTAAGACAA
GAATCAAAGTTTTAATTCCAAGTCACAGTGAAAGAAAAAAAGACTGTTGTTCATAGCAGT
GCCAACATTTGATGTGGAGCCTTGTGTATTTCATCACCTACATTCTGATGGCTTCGGCTC
CTCCCTCTAATATGTATAACTACTGTGCTTCGCAACCTGAGTTTCTGCGTTTGTATTTTT
AGGAGACCAAAGTTTTTTCTTAACTTTGCATTTTCAATTTGGTGAAAGCTTTTTAAAGCT
TATATTAGCATATCTAGATGACTCAGATAAGCATATTACTGTTGAATAGTCCATGAGGCT
TTTTTAGGTTTGGGTATGTGTTGCCCCTTACTTGTGTTGTCAAGGCATCAATGTGTGACA
GTACTTAGGGTTAAGAGCACAGTTCCTCAAGTATATTTTCTCAGTCTTAAAATTCTTCAT
AAGAACATTAGTTCTTCAGTATTTTTCCCTACCTGTAAGCAAGAATAACTATTCTACTTC
AGGAGCATTATGTAAAACACTATCTAAAGGATCTTGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved