Cavia_porcellus Locus Mono:451:SNORA61
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:451:SNORA61
Cavia_porcellus
Mono:451:SNORA61
scaffold_250962
SNORA61
1001..1122
2122
CTGTCTGTCTCTTTTATTTGACAAAAATGCAACAGTGGAAGCCTTAAGTTAAGGTGCAC
ATTATTAACAGCAGTCTTTGCAGTCTACTGGGGATTCATTTAATTTTCTCGGTCTGTGTT
TTCACAATAGTTTCAGGATGCTGGGGTGAGATATAGTTCTTGTAAAAAATAGTTTAAACA
GGTTAATTCATTTGGCTACCAGCAGGCTCGGAATACTTTTTTAAAAATTTAAATTCCAAA
GAAAAATGTGACACATACCCTTGTCTGCATACACAAGCACAACCACACAACACACAAATA
TACAGTGTTGGGAGCAAGTTTGAGACTGGACAAGAGGCACTTTCTTATGTATAAATGAGG
TTTTAATAAAACATCTTACTGTATGTTTAGTTTGGTCCATTTTTTTCATGGACGAGACAT
GTTAAATAAACATACATGTGCTCCTACAGAGTCTTTGTTTTTCAGTAATCACACTCTGCA
AATTCTAGTGGAAATTAAGAGGTTGCTTTCTCTACATGTTAGAAGTGGGTGATTGTATTT
TGTTTTACTTGTGTGATTATAGTTGATGCAGTCAGAAAATTCTTTGTCCTGACTTTCAGA
CTTTATGGGAACTCTGTTTCAATGCTGGATAGGTAGGAAGAGCTATAAATAATATGTGCT
GTGGATGTGTTAATAAGTTATTCTTTTCTTATAGCTTTTCCAAGAAATCATTCTGAAGGA
GAGGCAGGAGGACTAAGTCTTGCTGCTTTTAGAGCACACAAGAGGCAACTGACACTCAGA
ATAAAATGAAAATGTTTAATTTTTATATTTCTGATTCAGTTTGAAATGCAGATGAAAGTT
GAAATTTTATTTATGGCTTAAAGGATATCAGGGCCCCAAAACAAATCACGAAGAGACATG
GAAACCTAGTGGCAAATTTCATGCTAAAAATTTCATCATGTGTCGCATAGTGGTTATATT
GTACTACTGCATGTACAATAGTCATTCAAAATATAGCTGAGACCCTCCAGTTCCCTTTCC
TCTCAGATCTGAATGTTCGTCTTGGTGGCCATAAAGGAGGAAACAACACTGACGCTGGCC
TCACAGCCTGCTACTCTGGCATGTGGGCTAGTTTCAAATTGGACCGAGTTAAAAACAAGA
AAAACACAGTTGAAATTTTGCTGTGTGGTTAGGCCATTGGAAGAGCCTATGCAAAAATGT
TATGTGTCAAAGCATGGGAAAAGTAGACTGCTCCGGGCATTTGGTGTTATCAAAGACACA
TTGACCTGTTGCAGAGGTTTTCCCTGACACTGAATTCCCCAGCTGGGCCATCTGAGAACT
CAAGCTTTTCACACAAGACAAGGGTCAGGCGGAGTGCAAAGGATATTGCATTAGTGCACT
CCGCAGTGTGGAGGGTTAGGGGGCAAGCGGCCTCAGGATTTCTCACGGCCCCCTAACGGC
ATCAACGCTGCAAAATAAGCTCAATTTAAAGCCCCTAGACTCCAACCAGTGATGAAATAG
AGCCTTTTTTGCTGAGGATTCCATTTCAATAACACCTCAAATCTGTTTTTTGTCATTCTG
ATGTAGAAACCATACAGAGCCTCCAAAACACATAGGGAAAATATTTTAACTCCCAACCTA
CTAGCTGTGCAATACACTGAGTTCCTGTTTTCTGGAATTAAAGAATGCATTCTAAAGAAC
AACAGAGGTTTAGAATAAGAACTATTTTTTGAGGGAAACACAGCTCCTACCAGAGACAGA
CAGGAGGGGACCTGACAAGTGGGCTGCCCAAGGGCCACACTTTTCAGGGGTAGAGCACAA
CCACGTGGGTCCAACATGGGTTACAGCTATGATCAACCAATAAGATTATAAGCATAGTCA
CTTAGATAATATTAACCCAATGGGGAACATTTTTAGGAAGGGGTAAGTCAGAGTGTCGTG
GTCACCCACCAAGGTGTCTGATGTCTGTCTAGACTTGTCACCTCTTATCTTAGGCCTAGT
CATTCTGTCTTTATTTGGAGGCTTGGTCCCCAACAGATGCACTTCTGACCACACTTGAAA
CATTTTTTCATTTTTGCATTGACTCTCTCAAAGGCCCAATATTATCCCACCATCTCTACT
ATGTCTGCCTAAAGTTAGAGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved