Cavia_porcellus Locus Mono:674:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:674:SNORA70
Cavia_porcellus
Mono:674:SNORA70
GeneScaffold_7726
SNORA70
1001..1118
2118
AGAAACAGCAGTGGGGGTTGAGGAGCAAAACTCAATGCATTTCCAGGGCAGCATTCTGG
GGGAACAGCAAAAGTGAGATGCCAACGCCAAGCCTCCCGCATCCGTGCCATTCAACTTCG
CTTTGTATGAGGCTCCCCGAGCGGGGCTAGTTTGCACACCTGGATGAGGCCCGAAAGGAC
TCCGAAGAGCCAGTGCTTGCTGTAGACCGTGCCCCCAATGCAGTCTCCCCCGGCCTCTTC
AGCATTCTCATCTTCCCGACTAGTGGGCGGCGGCGACGGGTTACGGTCCATGATTGCGCG
CGCTTCTACCTTTCCGGAGCCGCGCCGGAAGCCGCGGGGGAAGCGAGAGGCCTCCTGGCG
CCAGAGAGCCCGGCAGCGCTTGCGGTGCTACTCCTGCCACAGCGCCCCCTGCTGCCCGGA
GTTCGGACGACCTGAAGGTCCGCTCAAATGGGATTTCCTCCATCCCTGTCCTGCTCTGCT
CTGCTCTGCTTTGCCCTGTCGTACCCTGCCTTTTATTGCCTACCCTACCCTACCTCCAGA
GCTAGGCATGATTATATTCGTAATTGTCATTTGTCATCTTCCCTAGATCAGAAATTTGGT
TTTTTTAGAAGTCTTTACCCTGATTTAGGAGGGCCCAGAATAAGCCAATGTTTCTGGTAC
AGATGTGAATCTTGAAATCATGATATCTTTGCTTTTGGAGCCCTAGAATATTGAAAATGT
TCTATCTGTGCCCCTTGAGACAGGATCTCATTAAATTATTCAGGCTGGCCTTGAACTTGT
GATCCTAATGCCTCAGTCTCCCAAGTAGCTGGAATTATAAATGTGTACTACCGCTAACAG
CTTTTGCCATTCTTCCAGTGTCTAGTACTACTATTAGTTTATGAGGAAATAAATTGCCTT
TAGTCATGAATGCTGAGCATTTTGTCTCTAATTTTATCCTCTCTCAAGTGACCACTTCAC
ATGAAGCCTGAAGTGAATGGAACTGCTTGCTCCTCTGGTGGCTGCAGCCAATTTATCCAT
CTAAACTCTGCTCCTTTCAGGAACCAGCTGTGAGATGGCTGCAAACAGCAGCCTCCTGGG
CAGTGCATTAGGCTGCCCTAAGAAGCCCTGGAGATAGCCATTTCCAGAGGGTGCTCATGT
CTCTGACACTGCGCTGTTCCCAATCTAGGCCCCAGACAGGTATGCAGGGTACTTTTGGAA
AGCTCCAAGGGATAGTGGCAGTGTTCACACTGACCAAGTCATGAGGGCCTTTAGCACTTG
GCTACTAAACAAGAAGCTTGTAACTGAGGCGCTAAACAGAGCCAAGCTCAAGTTCTCTCA
CTACCAGAAGATCCATCGCATTGCAAAAAATGGAGGTTTTACCAAATGCAATGCAGAAGA
ACTTGAAGACAGTGACTAAAAAACAGGTCATCCAGGAAGGCTGTAGAGGCTAAATACATC
CCCAGGACAAGTGGCTGGCCCTGCTCTCACAAGGGCTTCCTCCTTAAGTACACCCACCAA
TAAACCCTACTTCCTATCCAAAAAAACCCACAAATAAAAAGCTAACTCTGGTTGCAATAA
AATCAAAGGCATTGAGGTGACAGCCTTGGAAGCAACAAACAAAAAAATTGTCACCAAGGT
CTGTAAATAATCGTCACAGAGAGGGTTTCAGGAATTGATGACACAGGAGAGTCTGATGAA
TTAAGAACACTTTGAAGGAGACACAGAACTGATGCCCAGATAACTCAAGGAAAGGACTTG
CTGCCCAGCTACAGGAAATGCATCAGCAGACTGCGCCCAGCTGTCAGCTCCTTTGGGACC
AACCTTAGCTGCAGAGAGGCTCTGTTGTTCCCAGGTTAGCCCTCACTTGGTGACTGAGCA
ATGGGTTACAGAGATGAGATGTGGTACAAAGGCCTAGTAGCTTTAGTCTAATTTGGGACA
CTCCCACCAAGGCTTCCTACCATGTGCTGTGGCCTTGTGAAGCCTTCTACTTCTACTTTT
CTCTACAACTTTTTCTTTGCCTACCTATGTAGGTGGTCTATTGATCTTTAAATATCTTGA
ATCCCAAACCCTATGAAGCATCTATGTCCAGAGCACACAACTAGAACAGTTGGTACATCT
CGTTTCCACTGCAAGGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved