Cavia_porcellus Locus Mono:168:SNORA18
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:168:SNORA18
Cavia_porcellus
Mono:168:SNORA18
scaffold_242577
SNORA18
1001..1123
2123
ACTTCTCCACACAAACAGTGAAGTCAAGAAGAGCATGGATTGAAGTATTTTATCCTAAA
AGAAAATGATTTCCAACCTAGACTGGTGTACCCTGAAAAACTGTCCTTCAAAATGGATGG
ATAAATAAGATACTTCGCAAAAAAGAACAGCCTTCATGATCACCAAGCCAAACCTGCAAA
GAATACTGAAAGGCATTCTAGATACTCATAGGAAAAAAATCACTAAGTAAGGCAGACAAT
TAAACAGAATATAAAGATAAAGATGCAACAGCAGAAAGAGAACATCAAAAATAAACCAAT
ATATAAGATTTAATTCCTTTATGATACTGGAGGCTTACATCAGGCAGCTTTTAGGAATGT
CTTTGTGTTACCACCATAGTATAAACTGTCCCTTTCCCTTTTTCTCTAATTCAAAAAAAT
ACTGGGAAGATTAGAAGTTACTTGGCCTTATTGGAGTCATGAAAGGCAATGGACTGGATT
TTCATGGCTGACAGATTCTATCCTTACCTCAGCGTAACATGAGAGAGTTCTTTCTAAAAA
TTGGAGGAGTGTCCAGTAGGCTAAAAATTGCTGCCCAGTGCATCCTCTTGTCTGTATTTC
TTTATCTTCCATTGCTATACCACAACTATGTAAATATTCCTACATGCTTTCTATATTGGT
ATGAAGGAAAACAACCTTTTCCAAAGACAGCAGACAGTCAAGTGGCTGATCATCCATTTG
AGCCCAGAGCTCTCATTGCTTGCACCTTCTACCATGTTCTTGGGAAACAGAATTCCTACC
AATGAAGCCAGCCTAAGGTATATGTATTCAACACAGATATTTTAGCTTCCAACTCTAGAA
TCTTTGCTGTAAAAAAAAAAAATCAAAAGATTATATAACATTAACATATATGAAATTCTC
ATTGTGAGTAATTTTAAAAAGATTAGGCATAAACCACATAATCTGTTAAAACTACAAATC
TCTTATGCTGTTCTTCTGGTTTAAATGGAATTAGGATTGCAGGTGAGGTCTAGCATGATA
GGAGCTGTAGCTGTACAATGTTGGAAATGCCTCATAAAGTAAACCTCTGGTCTCTTTTTC
CTCATGAGACTATTAGCTCTGTGGGAAGAAACTACAGGACAATTAAGAAAAGAATAAAGG
GTCATTTGAAAAATACAAAAAATGAGACTATGATTATTTGAGGTTTTATTAAGTTGATCC
ACATGATTTACCATTTCACATAAGCATCCCACAAGCTATTCATGAAAATAAGAAATGATC
CAAATTATTCAAGTCCACAGCAAAAAGGCAGTAAGATACTTTCTTACATTGAGGATTCTA
TAACTAAAATAACTAAAGGACAAGACTAGATTTATATTTGGGAAATAACAGAGTAATACA
TTTTAGAAAGTAGCAGGCAATGAGAGTATTTGACTGCTGTAGTAATTCTTCACAAAGGTC
CTAAAGCCAAGGCCAGAGGCAGCACCACTAGTAACAGATGCTAGACAGTATAAACCTTGA
GTTACAAACAAAGAATGTTTTTAATCACTCAAATTTCACTGTAGATTAATGGGGATTGGA
GGTAGCATTTGTGGTGCAGTTACCTCCCTTGGGCTCCTTTGTTGATTCTACAGATACAAT
TAAAGATAAACCACTTTTCAGTCTCTGTTTTCATGAAGCTTACACTTCAGAAAGGAATAT
GAAGAGACAAGCAATGACAATGAATTCAAAGCAACCATGTTAGTACTGATAAATATTACA
AAGGCAACAAACATTAAAGAGGGTCATATATATCAAGGCTGGAAAGTACAGGTGTTACTA
AAGAAATACTTTACTGAAAAAGTGGATTATAGCCAAATCCTGAAGGAAATGAGACACCCA
AGCAGGTATGAATAGAGATAGTTTTTAGCCAAAGAACTGTCTCTCAGAAGGAAAGCAATG
TTTTCCAGAAGGTCATTTTAACAAGAGAAGGGTAAAGACGGTGACAAAATAGAGGACTGC
AGGTTCCAGGTCACACAGAGCAGCAATTTGGGGTTAAATTTTTTGCTGCTGTTGTTCAGA
AACTGAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved