Cavia_porcellus Locus Mono:702:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:702:SNORA2
Cavia_porcellus
Mono:702:SNORA2
GeneScaffold_503
SNORA2
1001..1118
2118
TACTAATTTCAGGTAAAACACACATAAACAAAAATTACAGTAAACTTCATTACGTGGCT
GTTAATAATGTTAGAATACGGACAGTGATGTCAAGGCTAGGCTATTTACTTAAAAATTCC
ATGACGAGGAGGAGGGAAGAGTAGCATAAGAAACCTACCGTACTGGATTAAAACAGGATG
ATGGTGTACAGTGCCCTAAGATTATTGAATTAAGATAACGGATACTCATTTTTATTTAGA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAATAAATATACTAAAACATCTTCACATTAAAAATTATCTACTGTTGTAAAAGTTGAG
TTTGATGCAGATATAGGCAGAACTTTAAGATACAGATAGTCCTGGCCCTGAATCAAGGCC
GGCAGCTTCCTGACGCTGTTGGTTTCAAGCAGGAGCCTAAAAAGATGCCTTTCTATGGTC
TTTTGGCCATTTCAGACCTTGGGCTTGAAGGAAACAACACCACCACCACCACCCCCGCCA
CTGCCGTGGTGAGCGGCTGTGAGCGTGGCAGGCTGTGATGGCTCAGGATGGGAGCCACCA
CCTGCGTTTACTGGACCCCGCGCCATGCTGGGACCTGGAGTGCCGGGAAACCAAGCAACC
CCGCTCCCTTGCCTGTTTTGTTTTGTTGAACTTCAATATACATGAAAGTATGGACAGCTA
TTTTGAAGAGAACAAGAGACTCTACATCAGCCGTTAGTGACTTCCCTGTTGTCTGGTTTT
GAAGACCTAAAACGCCTTTCTCATTCTGTTGGGATCAGTTTTATTCTATGTTGTTTTGTA
TGAATTCTCTGTATGTGAAGACAACTATTTGGAAGAAAACAAGAGACAATATGATAGTAA
AGGTCAGGTTGTCTAACTTTGAAATTTATATCTTACTTTGCTTTCTTATGTCCTATTTTG
TTCTGCTTTGATGTGTTTAATTTTACTCCCTTTAAAAAAAAAAAACTAAAAAAAATAAGA
TACAGATAGTCTCTTGTTAACCTCAAAGGTGATTCTCTAAAACAGACTGGATTTTAGAAG
GAAACAAACCAGTTAAGAACACTTTTCACATTTGCCTTTCGCAGCATGAAACCTCTCTAA
CAGGAAACATTTATACATGTTCAAGACAAACATTTGAAAGTAAAAATTTTCTGGATATGA
TGCATCATGCCTGTAAACTTAATTACTCAGAAAACAAGTCTGAGCCCAGCTTAAGCAACT
TAGCAAGACCCTGTCTCAATAAAATAAAATAAAATAAAATAAAGTGCTCAGTAGTAGACT
GCTTTTATAGCATGAACGAGGTCCCTGAACCAATCCCCAGCATTAGAAAAAAAATTTACC
ACAAAAATTTCAGATTGACTTTTTGTTCCTCTTTTTAAATTCCTATTTTTACTCCTCTTT
TCTCTCACTCTTCCTTTCCCTGTCTCTCCTCTCTGCTCTACCCTATCCTACTCTCATTTC
TTCTCTTTAACATAGTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved