Cavia_porcellus Locus Mono:676:SNORA63
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:676:SNORA63
Cavia_porcellus
Mono:676:SNORA63
GeneScaffold_4330
SNORA63
1001..1129
2129
CCTCTTTTGTCTTAATCTTTTAAAAAAAAAAAAAGTACTCTATTTCTTTAGTCTATTTA
TGAACTCAGCAAAATTAAAACAGGTAGAAAGAAGAGGGTAAGGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAAACCCTTCCCTTAAAAAGGAACTAACGTAAAATA
AAAGTCGCCCCCATGAAGTCTATCAATTCAGGCAGTCCCAGCGCCCCCCACCCCAAGGGT
TGGGATACAGCCTCCTGGGGAACAATAAGTCCAAGCCCCTCAGCAGTGGAAGGTATCTAG
CCCGGAAACTGTACAAAGACCTCCGCCATTCACTATTCTTTGTAGAACTGGAAGGAGAGA
AGTACTCAGGGAAGTCACTCCCTGGACATTAGCATTATCTTGATCCTAAAGCCAGACAAG
GATTTCAACCAAAAAAGAGAACTGCAGGCCAATCTCTAACGAGCACAGATGCAAAAAAGC
CTCAACGAGATACCGGGTAAATAACAGGTGGTGGTGGCAGCTTGCGCCCATAATCCCAGC
ACTTGGGAGGCCCAGGGAGGAGGATTTTGAAAGTTCTAGGCCAGGCTGGGCTTCATAGTG
AGTTCAAGACCACTGTGAGCTACACCGTGAGACCCTGCGCCACCCAGACAAAATACTGAC
AAACAGAGTGCAGCAAATCATCTGAAAGGTCACAGAGCAGGACGAAATAGGCTTCATCCC
GGAGATGCAAGGATGGTCAGCACCCACAGTCAGTGGCGGGGTTGCGCCACAGAAACAGAA
ACAAGGGGGCAAATCACACCACCTCACTAGATGCAGACAAAGCCTGTGACAAAACCCAAC
GCCCGCTTATGATTAAAAAACAAACAAACAAACAAACAAAGAAAATAGGTACAGAAGGAT
CTTATCTCATCTGATAAAAAACCACTAGGACATACCTACCAATGTCATATTAAAACTGAA
GGGATGTAAAGTGCTGTGCTGTCATTCCCCCAGCTCAAAATAAAGTTGTTTCTTAACTGT
ACCTGTCTGCCATGCCTGTGTAGCAGCCAGGGACGCTTGGTCTCATACATTGTGAAGGAA
AAAAAGAAAGAAAGAAAGAAAAAAATACTGAAGGAAAAAACTGAAGGTTTTGTAGCAGGA
CTCAAAATCAAGATCACACAAAGGTCAATAGCGTTCCTGTGCACCGATAATGAACTCCCC
AAAAAAGAAATTGTGAAAACATTCATAACAGCATCAAGAAAAATTACTTAAGGATTATCC
TAACAAAAAAAGTGAAAGACCCTGACAGTGAGAGCTACAGTACTCGAAAAGGTGATCGAA
GAGGAAGTGGAAAATGCAAATTACCCTGGGCTCCTAGGTAGGCAGAACCATAGTCAAAAC
AGCTGGCTGTACAGAAGTAATCCCTATCCAAACACCAGCGGCGCTCCTCCCAGAGCTGGA
GAAAATAATCCTAAAATTCACAGGGAACTCGAGACCCAGAATAGCACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGGGCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved