Canis_familiaris Locus GLTSCR2
snOPY snoRNA Orthological Gene Database
Canis_familiaris GLTSCR2
Canis_familiaris
GLTSCR2
1
SNORA54, SNORD23
2681..2813, 8404..8512
10247
gtgcagccccggcctgccgcccgcctctctgcgcctgctaccctttccgggccacaacg
gcctgcaggaagccccgggtccctgtgaatggttgccgggcccaacggcctccgagcttc
cttccttatttgtaagcggcaaaggcggagtccaccctgaagcctcaggggcaagccagt
gacagcagctacggttcagataaccaggcacactcttacgcgtcgcgtgtttattatctc
gtgttcgtctcccgagtaatttataaggccgatgtcccgtgatcgcccccattgcacagg
tgaggaaagtgcacagccaagcggcttgcccaggattaatgattccgcgaccgcaccgcc
aaccgtgtcggcttctaacagtcctcgcgaatgtggttctgtgctcccaactccacgttc
ggaaagctcttggatttccaggatttggggatcggaacactggaaaggcaaacgttctgg
gactagacggtgtcctatgctgaatctgccactgatggttctgattctttttttcaagaa
aactggattaaggggcgcctgggtggttcagtggttgagcatctgccgtggctcaggtcg
agatcctggggtgctaggatcaagccccatatccggctccctgcatggagcctgcttctc
cccctgcccaggtctctctctgcctctgtgtgtctcatgaataaataaataaaatcttca
aaaaaaacgtaagttaaaagttagagatatacgtaaatttaagaaatattcctgagcggc
cagaaaggcgctcacctaagggtagagccccgaacctccgacccacggtccacagaaatt
tgcctaagagggaggagacatttacactttgccccgccccctgggcgctccggctccttt
accaagatggcggcaaccggaagtagctctcgggagggggcgggagacctgcgcgcgcag
gccccaaactggcttccggggagccggctggggattgcttcCTTTGCCAAGATGGCGCCG
GAAGGTAGCGGCGGCGGCGGCGGGCGCTGCTCGAAAAGCGAGACCGACACCGGCTTCTTG
GGTTTCCGGCCCACTTCGGTGGACCCGGCGCTGAGGCGGCGGCGACGAGGCCCAAGAAAC
AAAAAGCGAGGCTGGCGGCGGCTCGCTCAGGAGCCGCTGGGGCTGGAAGTCGATCAGTTC
CTGGAGGACGTGCGGCTGCAGGAGCGCACGAGCGGgtgcgtggggcgggacttccgggag
ccgggccacgttctgagggaccgggtgcgaggccgacttccggggggctgcgcgcgtgtg
tttcgggcaccgctggactctcgtggcggtggggaggaggttgggctaccggggactcgg
caccccgtgttaaatgagagttcaggtaaatgactaataactagcgtaagtacgccttgt
gcacccacgttagcgtagtgccgaggattagtatttttaaatatgatttaagtgctgagc
tctgcgatctggagggagggtcttagcctggagggatcgcagggcgggaagaaggtgctt
ggatcagcacagcattagaggaaagcgggctcctgggacgttaaacctccctccccggca
tctttggctgacattctgcattcccctctcccagTGGCTTGGTGTCAGAGGCCCCGGATG
AGAAACTCTTCTTCGTGGACACCGGCTCCAAGAGAAAAGgtgaggaagaaatttctgtgg
tgcccgcttggtcctcatccagcccagcgcaacctctgagaaagtctctgttaaccgcat
ggcttggatcgcaggcgtctgctggagaggggaagggtctttactggtgcaggaggcctt
ggaatgcaagactaggagtcagatttcctttttgaggtctcggagctctcggtcttcacc
gtggcaatgctcaagcctccatctggcaggccggtagggatctgcctcagagtagattag
acataggtcagcaggtctctcgtgaacctgaaaaaaagcatttagtcagggacctgcggt
aagggataccgcgagacctgttgtagtaagatgggcttgagaaagaataagaggatctgc
tttcataagtaggtaagaagctggtcttaatctgcttacttttgtctgccaaaaggtagg
tcaggaggacctgctggaacaagcccaggagaggggagttagagaaggcttgagtcaata
ataagctttccgtaggtgagtaggaaaacagatcaagaacaggcagtggctttagggagg
gaatagaaagccagcccccaaggagctgctttgatgagtacactgcaagctgcttcacag
caggatgcccttagggagcatgtgtgggttccacccaggggcccattctaaggaacgtga
gaggacctgtttgatcggaaaaagagggacaaggacctgctttgaagtgcaggagactct
aagtgagcaggtgggagggatgatgaaagaggtcacccttcaggggagtgagcccatctg
gcttgtgaacagcaagcagagggccggacatgccccgatgaacaggtagggtagtcgatg
aacaggtagcggagtcggacggcctgctttggccagcgtgaagtctctttggaaatggga
gagatggtttaggttctgctgtcagtttgcaatgagagatgaggcactgttcgtggcctg
ctagcctggctgtggctggtgggctccattccgatgctacagcagctccagcagctccag
cggcattgtgactgaatgactcgtggctctcagtttcaggtcctggggacatgggaggga
agaaaaagaaagataatagtgattgtgagctttccttggtgatcaccgtgctttatgctg
ttgtagtgatggcctctccagagaaccccaggaggtaggcgttcaggctctttttggaag
cacagaggagcgaagtctcttctatgatgtatcctaggaaacggaaggatggaggttctg
tcctggcttgtttcgtcctggagtttgctttgcacagtcaggtggagaaaggcagaaagc
cattgtgctgagaatcagccattttgggtcaggagtctagttccctgggcctcactgtta
cttggtcgccttcttcttcgttagcatccgtggttttcctgtcttgtctggcagccctta
gagggcagggctgtgggcctgagcctccctctgttccctgcatagggctgcctctggcca
gcctggggcctccacatctgcaccctgatgcaggtctgatgggtgccatggagctgaaat
gcagcagctggggagctagtctttggaagcaaggaggccccagcccttgattgctctcct
ttctccccaccctagAGCTGGACAAGAAGAGGACCAGAAGCCAGAAAAGGTCACTTCTTC
TCAAGAAGCCCCTTCGCGTTGACCTCATCCTAGAGAACACATCCAAGGTCCCTGCCCCCA
AAGAgtgagtgccccaccatgccccagcccttctgtgtagctgccgtcactcacttctgg
ccctgggggtgttgctggggagggtgtgcgacaggaggaggggatgggcttggaggagag
ggatgggctcagaatggggctctggagagtgcattggaggaaatgagggggccagggtgt
tgtgggtgaggcaggctagtgtggggccttggcccagccaggagtcctggggagggggaa
gagggatgggcaggagccatcaggaggcctgtcaggctggctcagtggcagctctgaagg
aggggggtaatgagatggccttctgagattggggtatgggaggagcggctgtgggggtga
acctgaggttggtcttgaagtgacatatgaggtgcctgggagacccgcaggcagggtgag
ggccgctgaggctaccatgttgttggctcttgggtcagtggggaggaccggactagaaac
agacctggggcatgggctctgaagccaggtaggagggcgagaggagcccccggggaggtt
gggagtgcttgggagaggagctgctgagtagtaagggtgcagagcccaactaggaggagc
cgggcctcttctcaggcctccgcctcacctactccatctgtgtgcctctcctccatccag
TGTCCTTGCCCACCAGATCCCCAATGCCAGGAAGCTCAAACGGAAGGAACAGCTATGGGA
GAAGCTGGCCAAGCAGGGCGAGCTGCCCCGGGATGTGCGCAGGGCACAGGCCCGGCTCCT
CAACCCTCCCAAGACCAAAGCCAAGCCTGGGCCCCAAGACACTGTCGAGCGGCCTTTTTA
CGATCTCTGGGCCAAAGACAgtaagtgcctttgctgttacttgcggtggggataaggctg
ccatgcacagttgtgcaggttgtgcactgcacaagagcacagtgtcaaagggaggtgctc
tgcagatgttggtttgatgatcctcagcagagtttggcatcttgaaggggcttccctttt
cctggtgcatttacctgagggccacccccacctctcagctttggttcccatgtgctttct
ggtttgtctggcattcaaaactccttggggtctgcgtagtccttcccttgtcctagtcct
tcctttgtccgtgctttggtgctgtctctatggggggtggcggtgggagggagcccttca
atccacagtggaaagttcccagcagacacccctcactgcctccacagACCCTCTGGAGCA
GCCCTTGGCTGGCCAGGACACCTTTTTCCTGGAGCAGACCAAGAAGAAAGGGGTGAAGgt
gagactgtggcagcagggcatcctgggcgctggtcggaggagggttgtgtggtgggaatt
gtgctggagccttgaagcctcggtctcagcctgtggccgagaccacagacgcaggagcca
gccctggagcggtgcctccagaggagagcacagagtggcggcggcggcagcaggaggggc
ttggggatgaacaaggcttcattggtgagaggcctgtgcagacagggtctacctgggcag
gcgggcggcctagcagtacccagttgggagggaagacggaagggcctccaggcagaggac
aagagagcaagggcgggggtgtggggcagtctggggaggaggccggcctggtgggaggga
gcacaactcagggtttggggttttactttggtttcatctaggagggagggggcagccctg
gaacccaagacagcacccttgggcagttgggggtgggggcagggggcttccagggttacc
ctaaggcttctgctggggtggaggccagatggacaaccatcccctccgcaccctccgccg
cgggcttgttgggggtcctgagtcctgattggactcagattcagtccccgtggacctggg
tctctgtgtttgtcacaagctggacctagggccacactccctgctttgagtgatggacag
cacctcacagcctctgccaatctgctgcagtgtgtcacaccaggatgatgcactggtgac
taagatcaaggtgcccagtgccccgtgtttttgcaagctttgcccaccatgaggttacag
ggccttctcaggaaaggcaggcagagtccctccctgcagggagctctcttgtcctgggga
tgtggctcccgtgggtaacatggcaggtgggtggcaggtgtccacatgccagaccctcag
acacctcccagtgtgaaggctgtgggccctgctgaggcccctgccatcttctgagcctgg
aatcccagctccagaccttgtgaggtcttgagtcgtggggctgccaggcttcatcctacc
ttgtcctcccccagCGGCCACCACATCTGCACATCAAGCCCTCCCAGGTCCCTGCCGTGG
AGGTGACGCCTGCCGGAGCCTCCTATAACCCATCCTTTGAGGACCACCAGgtacttggcc
tcttaccaggcacctcctctgcgtccacccctgctggggtggcagcagtgactgagacag
ccccctgcctgccctcctggggctcctggtccagagggctgggaggagggaacccagagg
agccgccaaacctggccttgggggtcagggagggcttcctacaggaaggggacatcagag
ctgagaccaaaagaagagtttgccgtggggagaggggaacgggcgtttcaggcatgtgca
aggaacagcgtgtacaaaggcctggaggtgtatgagaccatgctgcctttcgtggaagtc
catgggacttgggtgcagaaggcctcaatgaactgttagcagagtggccagctgaggtgt
gcctgaggcctaggctaggtcagcatgggccacctggctgtgagagtcgctgtttatatc
agtgatgatgtctgttaagcacagaggttgggaacagaggggacaccccccttgccctcg
gggagcacaggatctcagagagatcagatcattgaggagacacaggacacgtgggcgagt
gctgttcagcctcgttcatgataggagagtctcttacccaggagtttccactcctgataa
atgatgtcagcgggatccctgggtggcgcagcggtttagcgcctgcctttggcccagggc
gcgatcctggagacccgggattgaatcccacatcgggctcccagtgcatggagcctgctt
ctccctctgcctatgtctctgcctctctgtctctctctctgtgactatcataaataaata
aaaattaaaaaaaaaaaaaatgatgtcagcacccgtgatgccgaacatgagtagggtgag
gttggcaacaagcagaggaggccacagactgcagtgcgttcccctgtggactgacacggg
tgctgggggagaatgtgggaagatcagtctgtgtcttttgttcttcacgtagcgtatcac
agagagagttcccacatcttaggatttgcccactcacacgcacaacttaatggcttttag
cgtatttgcaggcttgtgtggccctcgcccgtgggttaggatgttttcatcaccccagaa
agaaagtgcatccactggtcgtcaccccctgtgcccgttctgggtttcacataaatgaaa
ctgtactctgcagagatgagggaccgggccatgcttcaagagaactggcagggcaggcag
gaggttcaggaatagaaagcacctcctggctgcatggagacactggggagactggggatg
aggagggggcctggggcactgcgggtgggaccagctccgtctgtaagtcccaggagaggc
cctggggtggggggcctgggtcatcacccccaaccctttcccctcccagACCCTGCTACT
GGCGGCCCACGAGGTGGAACTGCAGCGGCAGAAGGAGGCCGAGAAGCTGGAGCGGCAGCT
GGCCCTGCCCGCCTCAGAGCAGCCTGCCACCCAGgtgagcccacacctgcctctccccca
ctggctgccactcctgcctggccccgcctggcccctgacacactgtctcctcccccctcc
cccaccagGAGTCTGCGTTCCAAGAGATGTGCCAGGGGCTGCTGGAGGAGTCGGACGGGG
AGGAAGAGCCAGGCGAGGGCCCGGACACAGTGCCGGAGGCTGGAGGAAAGCAGACTGAAG
GAGCAGAGACATCGCCCACACCTGTGCGCCTGGCCGCCATGGAGAAGAAGACAGAACAGC
AGAGGCGGCGGGAGAAGGCCGCCCAGAAGATGgtgagcactgggtttccagcccgctttt
cctgcttctccaacagcacctggcctcaggatgcagcagggaatgttctagatcaagtct
ctgctgccctggtgcttatattggggtgggatttacagaccaccaatgtacaaaaaaggt
ggtttctgaagacaatggttgtgaaacagtcaggggaggtggcccgggtcgtgctctgtc
gggccctaactccacccatccctgctgcagCGGGTACAGCAGGCCCAGGAGCGGGCTGCC
CGGCTCCGGCACCAGGAGCTCTTCCGGCTACGCGGGATCAAGGCCCAGGTGGCACGGCGG
CTGGCGGAGCTGGCACGGCGGCGGGAGCAGCGGCGAGTGCAGCGGCTGGCGGAGGCAGAC
AGACCCCGCAGGCTGGGGCGGCTCAAgtgaggcccagcggggggtgaggggcagggggta
gtggtcctggttccctgcctggcctcctcctggaagaccatctcttctctggaaggcctg
ctgcccaggtggggcctctggactccgccctgagcaaggctgaccctctgaacaccgcac
gcccttgttctctagGTATCAGGCCCCTGACGTGGACGTGCAGCTCAGCTCGGAGCTGGC
TGACTCGCTCAGGACTCTGAAGgtacttgaccatctgggatgacacactgtaggggagac
cctgtgcccagtgatgatacccatccttgctccccgtgccccccgggctgtgggcgacat
catggctgcccccaggttgtgccagttgggctgatgcctgggggctgagggcacggggtc
ctcggggcgaggggcttgctggggtggttgttttagcccatggccctgggaatgtcttgc
ctcccagccaggccccgaagcagccactggtgtcctggccccagtccccccacttcggtg
ccagagaggcctccctgaagctcatgatgggtcttgtccgtccccggcccagaacctgct
atggctccagtggcctccggcttctcaccgacgccaagggccctctggcttggccggcct
cggggctgcagccaactctgcttcatgagcgggccagccctgcaccctattcctctggta
cctgggctgtgcccctgctgctccccctgtgtggcacagtctactttgtcagccgcctcg
gttctgttgactctgcaaacctagctcaggcggccagtgggtccatacacggcgccccag
tagcacagggccaggctgagccccgcagagaggtcagaccctcccacccactgctgctga
gcctccctctctgtcccgcagCCCGAAGGCAACATTCTCCGTGACCGTTTCAAGAGCTTC
CAGAAGAGGAACATGATTGAGCCTCGGGAGAGAGCCAAgtgaggaccttggggctgctgt
ggggagtgagggcattgggaaacttctgctcctgggctcgctgggctcaacccctttcct
cctacagGTTCAAGCGCAAGTACAAAGTGAAGCTGGTGGAAAAGCGGGCGTTCCGCGAGA
TCCAGTGAgttgcactccctcccctgccaggccgactggtctcttggctgactggtctct
tggctgcagcagcagaaacattggaaacactgctgagctgcttaaaaagaatgagctctt
gtcctttatggtggtgtcccctgggtcccagggcccatcccgaacccgggaactgaccag
tggctgagtgatcctcccctggcccgaggggcagcccaccatgtgcactggaactcagag
tcagggccgggcggaaggggtccccaaagggaaatagaaggacccagaccagagttgggg
atgtcaggtgggtgaggccaaggggcccttcctcccctcatacaccctcaatcccgtctc
ctctgtccacaggttatagccatcactgaatgctggagcccccaccctacaataaaacac
cactgatcgacatgttgggcgtcgtgtgtgacttgtctccctcctgggggcggcttccct
ccctgggtatctctccctagtacatcgagctccttagggaaggcaggtgaagtgacaagg
cttgcaggctggtgggggagtggagcgtggagctcacaactgggggtctgacaggaaaca
gcccccagctctctgccggggtggctgaggtgcaggtcttgagtacaggcctgtcacatt
ggtagtgctgactttggtgagcgcctgctgtgctttgaagcaggtggattcacgtccaac
aacccaattatagggagggcagtcctctctattctaaaggttagggacctgaagcacatc
agaaggaactactctcttctccccataactattgaaagaggacttttttgaccttttttt
ctaataaaggactatattctcaccgtacattgttgatacggcacataaagatacctaaac
accagaagtcttgccctgaacctttgtttccattcaaacccactctcttctctgcaaagt
agctgtcactgatgttcagcgtgaacgattccagtgtgttccatatgt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1234, 1654..1718, 3375..3483, 4140..4339, 4727..4797, 5834..5929, 7309..7413, 7508..7711, 7950..8125, 8295..8361, 9021..9097, 9187..9247
1011..1234, 1654..1718, 3375..3483, 4140..4339, 4727..4797, 5834..5929, 7309..7413, 7508..7711, 7950..8125, 8295..8361, 9021..9097, 9187..9247
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved