Canis_familiaris Locus NP_001003350.1
snOPY snoRNA Orthological Gene Database
Canis_familiaris NP_001003350.1
Canis_familiaris
NP_001003350.1
1
SNORD32, SNORD34, SNORD35
13073..13154, 14099..14171, 14360..14446
16039
AGGAGAGACGCTTCTAGAGAAGAAAGCCAAGTGAAGACAGAAGCAGGGATGGAGTTATG
CAGATACACCAAGGAACCCCGGAGCCCCCCAGAAGCTAGCTTTGCCCACACATCCAAGGC
GGAGGTGGGGCTGTGCCCGAGGGAGCAGTCCCGGAGGCCAGGGCAGAGCCGCAGCAACAA
AGGCAGCAGCAGGGGGGGGTCAATGAACCCAGCTGGGGGTGGGGGTGTCCTCGGTTGGCT
CTCTATGTACCTGTCACCTGCCCCCCCACCCCAGCGCCAGTCTGTCTCTCCTTTTCCAGA
TCCCATTCCGCCCCGGCCAAAGCACAGCCCTCCTCCTCCTGGCTCCCGTGTGCATCTCGG
ACCGGCCTTCCCTGTTGGAGGCGAGGAGGAAGGGCCCCAGGCTGGCCCCCTTCCAGCTGA
AGGCAGCCCCCCACTCGCCTGTGTCCCAGCCTCGACTCGCCTCATTGCTCTGGGGAGCGA
GTCCCGCGGAGGCGCCCTCAGCCGCGTGAGCCGCCACCTGTCACCACCAGGTGGCGCCCC
ATGCCTCAGCCAGATCCACCCCAGCTCTCTATCGCCCCCCAAAATTTCCTTTCGCTTTCG
ATCTCCGGCTGTCACCCGGCCTGGCCCCTTCCACGCCCAGCTGGGGCAAGCCTGGTGCGT
GCGGAGAAACGGACTCCGGGTCCCCGAGGGGCGGGGCTGGGGTCCCCCTCCTGGCCGAGG
GAGGAGGGATGGGGGTCAGGTCGCTGGGTCCCTGGCCTGGGGAGGGTTCCGGGGACCGGA
CGTCGGGGTTCTTAGAAGGGGAGATGCGTTTTCACCGTAACTGGGGCTCACGCAGGAAGC
CCGAGGGAGTAGGAGGCGGAAACTTAGCCACATCAAGGAGTCAGGGGAGGGGTGGGGAGG
TGAAGGGGCGGGTGAGGAAGGGGCTGGGGTGTGGGGGTCTGAGACTCCCTCTTCTGTCCC
TTCCAAGATCTGACCATAGGCATGAGGGGCCTCCGGCCGAGATGATAGTGCTGGCGCCAG
CCTGGAGCCCAACTGTGCGTATACCCGGGGGACAAGGCGGGGGACAGGCAGAGCGCTACC
GAGCTGGGCAGAGCTGAGAGAGCAGACGGACAGAGGTGGGGGACGTGCGCAGGGGGGAGG
GAGAGATGGGCAGGGGTGGGGACATGGGCAGAGGACCGGGACATGGACAGGAGTGGAGGA
CATGCGCAGGGGGCAGGGGTGAGGGACATGGGCAGGGGCGGGGGGGGCATGGACAGAAGT
GAGGGAGAGATGGACAGGAGTGGAGGACGTGCACAGGGATGAAGGACACGGGCAGGAGCG
GGGGACACTGGCAGGGGTGGGGACATGCACAGGAGTGGGGGACATGGGCAGGGATGGGGA
CATGCACAGGAGTGAGGGACATGGGCAGGGGGGACATGGGCAGGGGTGGGGTCATGGGCA
GGAGTGGGGGAAAGGAACGGAGGCGGGTGGGTACACGTGGGGAAGGCAGGCCCCGGCGGC
GGGCGGGGGCCAAAGCGGACACAGGGACCGAGAGGGCCAGGTGGGCGGCGGAGGGAGCCG
GGCGCGCCGAGGTGAGCAGAACCGGGAGCCGACCCGGGAGCCCGGGCGCCGCCGGCCGGT
GCTGAGAGCAGGCGGGGACGGGCGGCACGAAGGCAGAGAGGGAACCGGGGAGGAACCGGG
GAGGAAGCGGCGGGGGCCGAGCCGGGACCGGAGGGAAGAGACCTGGAGAGGGCGGAGGGG
GCAGGTGAGGACCGCGTGCGGAGCCAACAGGGGGCGCCCCCACCCCGCAGGCCTCCCTGT
TGCTGCTGCTGCTGCTCAGCCCCGGCCTCCGCGGGACCCCCGACTGCTCCTTCAGCCACA
GCCCCATCTCCTCCACCTTCGCGGTCACCATCCGCAAGCTGGTGAGGCCCGGTCCCAGCC
TCCCCGACAGCCTCCCCGAGGCCCGGGTCCTGGCGCGGGGACCGAGCTCCCCTGGCTCCG
TGTCCGTCTGTGCGGCTCCCTGGGCCCCCTTCTGGGTGCCTGTCCCCACCACCACCACCA
CCCCGGTCCGCTCCCTGTCCCTCACTCCCTGGGTCCCTGTCCCCTTCCCCCTGGGTCCCT
GTCCCTCACTCCCTGGGTCTCCATAGTTGTGTTTTCTCCTGTCTTCGGCCAGGCCTCACC
CTGTTTTCTCCCGCAGTCTGATTACCTGCTTCAGGACTATCCAGTCACTGTCGCCTCCAA
CCTGCAGGACGTGAGTCACAGATGGGAGAGGCTGGGGCAGAGGTGGAAAGGAGAGACTCT
AGCACACCACCCCTCAGGGGGCCCGGCCTCCCCCGGGGCTGTGGGACTCCTAGCCCCAGC
CCCTCACCCTCCCAGCCCCACCAGTCCAAGCTCACAGTCCTCTCTGCTGGCACCTCCCTT
GACCCCTTCTCCCCACCCCTACTGAGCTGGGCGGTCTCTCTCCCAGGACGAGCTCTGCGG
GGCGTTCTGGCGCCTGGTCCTGGCCCAGCGCTGGATGGTGCGGCTCCAGGCTGTGGCTGG
ATCCCAAATGCAAATCCTGCTGGAGGCTGTCAACACGGAGATACACTTTGTCACCTTCTG
TGCCTTCCAGGTCAGCCCTGGACTTGGGGGACAGGCTAGGGGAGCGGGTTGCCTTCCTTA
GGGCCTGAAGCTCTGCTGGACATTACTGGAGATTTCTTTTGGCTAGCAACCCGAGGGAGG
TGCTCTAACCCGGTCCCGCAGGTGGTGGGGGTGGGGTGGGGGGTGGCGTTGGGATCCTGG
GCCCAGTGCACCAATTCTGAGTGTATTTCCTAGCTGGACACCACAAAGAGGTCCTCCCTT
CTGAGACCCAGCCCCCCGCCCAGGGGACCCTGTAGGCGTGGCCAGGCAGGGAAGGCCCTG
GCCTGAGCAGACAGCGGGGGTGATGCCCTGGTGACATCTCCCTCCCCTGCCCCCAGCCCC
TCCCCAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCACCTCCTGCAGGACACCTCCC
AGCAGCTGGCCGCCCTGAAGCCCTGGATCACCCGCAGGAATTTCTCCGGGTGCCTGGAGC
TGCAGTGTCAGCCCGGTAAAAGCCCCACTCCCTGGGCCCCCAACCCCCACCCCGCTCACC
CCTACCTTCCCTAGCTCACAGCCCCTCACGCCCTCTGCTCAGGCCATCCCAGACCCGCCC
TGCTCCCTCTGGCTGTGTGGCTTTGGGCAGGTTCCTCTTAAGTTTAGGCCTCAGTTTACC
CATCTTGGGCAAGGGTAATTGCTGCCTGCTTCTCCGAGACAGCCCTGTCAGATAGAAACA
TAATGATAGCCACGTGCTTGAGTGGAAATATTCTAGTAGTCAAGTTGTTTTTTTTTTTTT
TTTTTTAGGTAAATTCACTTTTTTTTCCCCTGGAATTTTTTTTTTTAATTTTTTTTTTTA
ATTTTTTTTATTTATGATAGTCATCATAGAGAGAGAGAGAGAGGCAGAGACACAGGCAGA
GGGAGAAGCAGGCTCCATGCACCGGGAGCCCGATGTGGGATTCGATCCCGGGTCTCCAGG
ATCACGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGCGCCACCCAGGGATCCCTCCCCT
GGAATTTTAACGTTCATTATTTTTGGTAGCAAATGATTGGTTGTTTTAGTTGTATTTATT
TTTAAAGATTTTATTTATGTGGGGCAGCCGGGATGGCTCAGCGGTTTAGCGCCACCTTCA
GCCCAGGGCATGATCCTGGAGTCCTGGGATCGAGTCCCACATCTGGCTCCCTGCATGGAG
CCTGCTTCTCTCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCTGGGTCTCTCACGAATAA
ATAAATAAAATCTTTAAAAATAAACAAAACAAAACAAAGGAGGGTACAAAGAAACGTATG
AGGAGGTCCCGGACACCCTTTCCCCAGCCCTCCCCAGCCCCAGGGTTACATTTTGCTTAG
TGTTGCTTACAGCACGATAGCAAAACCAGAAATATGACATGGGTCGCAGTCCATGCATAT
AATCCACAGGGTTTATTCACATTTTACAAGTTATGTGGGCACACTCGCGTGCACTTGTGT
GTATGTTAGTTTGTTAGGGCTCCCCTAACAAAGTACCACAAACTGAATGATCTGAACAGA
AGTGTTTGTTTCACAGTTCTGGAGGCCAGGAGTCTGAAATCAATGTGTGGGTAGCATTGG
CTCCTTCTGAGGCCTCTGAGGGAAGGTTCTGTTCCAGGCTTCTCTCCTTGACTTGTTGAT
GGCCATTCTCACGTTCACAGGGTGTTCTCCCTCTGAGCACACCTTCACATCTGGATTTCC
CCTTTTTATAAGGTCACCAGTCCTATGGGACAAAGGAAGTGCCCTGATGACCTCATTTTA
ACTTGATTATCTGTATATATACCCTATCTCCCAATAAGGTCTCATTCCAAGGTACTGGGG
GTTAGGATTTCAACATAGGAATTTTGAGGAACACAGTTCCCTTTTCTTTTTTTTTTTTTT
AAGATTTTATTTATTCATGAGAGAGGCAGAGGGAGAAGCAGGTTCCATGCAAGGAGCCCC
ATGTGGGACTTGATCCCAGATCTCCAGGATCATTCCCTGGGCTGAAGGCAGTGCTAAACT
GCTGAGCCACCGGGGCTGCCCCACAGTTCCCTTCCTAAAAGTGTATGTGTGTTTTTGCAG
TGTTATCACATGTGTGGCTTCTTGCAATCAACCACCACAATCAAAATACTTTACTGGATC
CCTTTGTAATAATTCCCATCCCTAGCCCCTGGCAACCACGAATCTGTTCTTTATGATGAT
GTTATTGGACTTAATCATTTTATAATCACTCTTCATAATTAATCATTGAAATCATACATT
TTTATTTAGCCAAACATCTCTTAAATAGCACTGTTTGAACACATAGCTAATATTGTATCT
TTGATTTGATTCTATTTTTCTTTAATTTATTTTTATTTTTTATTTTAAAGATTTTATTTA
TTTATTCATGATAGTCACACAGAGAGAGAGAGAAGCAGAGACACAGGCAGAGGGAGAAGC
AGGTTCCATGCAGGGAGCCCAACGTGGGATTCGATCCCAGGTCTCCAGGATCGCGCCCTG
GGCCAAAGGCAGGTGCCAAACTGCTGCGCCACCCAGGGATCCCAATTTTTTTTATTTTTT
AATTCATGATAGAGAGAGAAAAAAAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGTC
TCCATGCCGGGAGCCCGATGCGGGACTCGATCCTGGGTCTCCAGAATCAGGCCCTGGGCC
AAAGGCAGGCGCCAAACCGCTGAGCCACCCAGGGATCCCCAGATTCTATTTTTTTTAATG
TAATCCTATCCCCAATGTAGGGCTTGAATTCACAACCCTGAGATGAAGAGTCGCATGTGC
CACTGACTGAGCCAGGTGCCCCTGAAAGGGATACTTAAAACCTCCCACTCTGATTTTCTC
ACTTTCTCCCCACACTTCCGATCATTTTGCCATCTATTTTAAGCTTCACTTGTCATTTGT
ACTTATATTTATGATGATGATTCATTTGACCACATTTTATTAGCCATCTCCTTGGTGCCT
GGCTTTGGTGACAGGGCTCAGAACAAGACCAAGTGCTTGCACATGTGGAGCTGATTGAGG
AACAAACGTATTAGCAAATAATTAACAGGAAAAAATATCTGAGTGTAATGAGTCCTATGC
AGGCAAATTACAACCAGGTGATGGGAGTCATGGTGTGAGGTGAATGGCTTGAGTCACTGA
AGGTTGGGAATATGAGAACACCCAGTGCAAAGGCCCTGAGGCAGAAACATGTCCCTACGT
GTTTAAGGAACAGTGAAAAGGCTCATGTGGCTGGAATCCAGCAAGTGAGGGGAAGAGACA
GCTGGGTGAGGGTATAGAGGGAACAGAGATTGGGAGGGATCTTTGTTTTATCTGTCCACT
TGTCAATTTTTCATTTGGTCAAATATTTAGTTTATGAAATTAAGCTATTATAAAATTATG
TAACAAGCACCAAGTGGTGGGTTCTGGCAATAAATAAGACAGATAAAGTTCCTGTTGCCC
ACGTGAAGCCCACAGCCCACTGGAGGAAAAAGAGGAATAAACAAATTGATACAGAAGCAC
TAGAAATAACTTTGTTCAACTGTAAAAAAAAAAAAGGCAAGGGCACCCAAGTGGCTCAGT
TGTTTGGGCATCTGCCTTCAGCTCAGGTCATGATTCCAGGGTTCTTGGATCAAGTTCCAC
ATCAGGTTCCCTGCTCAGTGGGGTGCCTCTTTCTCCCTCTCCCCCTCCCCCTGCTCATGC
TTGCTTTCTCTCTGAAATAAATCTTAAAAAAGGGCAGCTCCAGTGGCCCAGCAGTTTAGT
GCAACTTTCAGCCCAGGGCATGATTCTGGAGACCCGGGATCAAGTCCCACGTCGGGCTCC
CAGCATGGAGCCTGCTTCTCCCTCTGCTTGTGTCTCTGCCTCTCTCTCTCTCTCTCTCTC
TGTTTCTCATGAATAAGTAAAATCTTTACAAAAAAAATTTAAAAGAAAAGGCAAACTTAC
CAGATGCCACACTGTTCTAAGGACTGTCTGTGTGGTCACGTATTTAATTTTTGTGACCAC
CTTATGCGGTAGGAATAATGGTTATCCCCATTTCACGGATGAGGAGACTGAGGCACAGAG
AGGCCAGCAGCCCACCTGAGGTCACACAGGTTCCACCAGGCCTGCTTGGGTTTCCTCCTC
TCCCCTGGCCTCACCAATCTCCTCAGTAACCCGGCCACCCTCTCTCCTCCCCTCAGACTC
CTCTACATTGGTGCCCCCAAGGAGCCCCGGGGCCCTGGAGGCCACTGCCTTGCCAGCCCC
TCAGGCACCTCGGCTGCTCCTCCTGCTGCTGCTGCCCGTGGCTCTCCTGCTGATGTCCAC
TGCCTGGTGCCTGCATTGGCGAAGGAGGCGGCGGCGGAGGTCACCCTACCCTGGGGAGCA
GGTGAGTCAGCAGGTAGACAGAGGGGATGGGCAGTCTGAGGGGGTGGGTTTGACCCTGTG
GTGGCCACAGGTGACCTCCGCCCCCCAGTCTCCAGGACAGGCTGCCCCTGTGGCTCGTGC
AGCACTGACTCATCCTGGTGAATCCTTTGGTGGGAGGACCTAAGTCTGCCCTGGATGAGG
AAGACCCCTCTGGGGCCATGACAGGGGACAGACTGGAGGCTGGGTGGTGATCCAGGGAGA
GAGGACAAGGCCTGAGTCAGAGCCAGGATGAGCACCATAGGGAGGCCGAGGAGGCGACAA
AGTCAGGGGTCAGGGATCAAGGACAGGGCTGGAAGGGCACCTGGCTGGCTCAGTCAATAG
AGCAAATTACTCTTGATCTCTTGGCTGTGAGTTTGAGCTCCACATTAGGTGTTGAGATTA
CTTAAAAACGAAATCTTAAAGGACAGGGCTGGAGACTGACAGGCTTGGGCCAGTGACACA
GATGACCCTGGGTCTGGCCCAGTGGGAAATCTGGGGGAGGATGGAGATTAAGAAAAGGTG
AGCTCAGTGGGGACCTGGGGGCATGAGGGGGGCCAAGGGGAGGCATTTGGCTATAGGAGT
CTGCAAGCCAGGAGACAGTAGTCTCCTGAAGCAGGGGGAGAGGACCACCTTTGCAAAGCC
CTCCAGGTGTGAAAAAGCTCTGGGTGTTCCAGTAACTTCATTGAGCCTGGGGAGGGTGTG
AATGTGGGTGCGAAAGATCTAGGCCTCAAACACCAAGCAGGGGAGCTGGGACTTCCTGCC
CAGGGCAGCAGGGAGCCAGGGGAGGTGAGTGATGGAAGAAAGAACTGGGGGGGAGGTCAG
GGGAACAGGTGTGGAGGCAGGAGGCAGGTGGCCAGGAGGGAGGAAGTTGGGGAGGCCCTA
TTGGGTTCTTGATGGGCCCAGTGTTCTTACAAGAAATATTTTGCAGTAATTGCTCACACA
TATAAGGCCTCAGTGATACAGGCCTTATGCTAGGGCTTTCTACAAATTAACTTAATTGAG
AAGCTGGTACCATTATTATCAAATTTCATAGAGGCTGAAACCAAAGCACAAAGAGGTAAA
TAATTTGCCAAAAGTCATACAGCACATGAGTGACAGAACCAAGATTTGATTCTGGGCCTT
CGGGACATCCAAGCTTTTCATTCTTCTGCCTCAGTTTCCTTATCTTTATAAAAGACTCTA
ATAATAGTCTTCCTACCATAGAGTTGTCTGGAGGTTAAGTGATGCAGGCAAAGGCCTTAA
AGTGAGGCTGTCCAACAGAAATAGAACACAAGCCACACACGTCATTTAAAACTTTCTAAT
ATTGGGGCACCTGGTTCTCTCAGTTAGTAAAGCATGCGACTCTTGATCTCAGGGCTGTGA
GTTCACGCCCCACATTGGGCACAGAGATTACTTAAAAAAATAAAAAACTTTCTAGGGGCA
CCCAGATAGCTCAGTTGGGTGAGCGTCCAACTCTTGCTCTCAGCTCGGGTCTTGATCTCA
GGGTCATGGGTTTGATCTGCGCTGGGCTCTACAGTGGATGTGAAGCCTACTTAAACAAAC
AAAAAATTTCTCCACATATTTAAAGTTCTTGAAATTTACATTTGCAAAAAAGTAGATTCA
CCTGCTCAAATTGTTCCAAACAAGTTTCCAAAAAGGGGCAGCCCGGATGGCATAGCGGTT
TAGCGCCACCTGCAGCCCAGGGCGTGATCCTGGGGTCCCGGGATCAAGTCCCGCATCAGG
CTCCCTACATGGAGCCTGCTTCTCCCTCTGCCTGTATCTCTCATGAGTAAATAAAATAAA
AATCTTAAAAAAAAACAAGTTTCCAAAAAGAAACAAGTTGTTTTTGCTATTTTTTTAAAG
ATTTTATTATTTGAGGGATCCCTGGGTGGCACAGCGGTTTGGTGTCTGCCTTTGGCCCAG
GGCTCGATCCTGGAGACCCGGGATCGAATCCCATATCGGGCTCCCGGTGCATGGAGCCTG
CTTCTCCCTCTGCCTGCGTCTCTGCCTCTCTCTCTCTCTCCCTGTGACTATCATAAATAA
ATAAAAATAAAAAAAAAAGATTTTATTATTTGAGAGAAGACAGAGCACCCTCAAATGGGG
GGAGGAGCAGAGGGAAGGGGAGAAGCAGACTCCCCACTGAGCAGGGAGCCCATGGGATCA
TGACCTGACCTGAAGGCAGACACTTAACCAACTGAACCACCCATGCACCTCTCCTTTTTT
TCTCTTTTCTTTTTGATAAAGAGCAGGGAGGGGGGAACAGAGGGAGATGGTGAGAGAGAA
TCTTAACCAGTCTCCACTTCTACCATCAAATTGACTGGGGACTTGATTCCCTCACCCTGA
GATCAGGACCTGAGCCAAAATTAAGAGTCAGATGGGGTAACTGACAGCGCCCCCCCCCCC
CCAGCCCCAGGATCAGTTTCTAAGTTTACTTTATTTTTAAAGATTTTATTTATTTATTCA
TGATAGTCACACAGAGACTTTTTTTTTTTTTTTAAGATTTATTTATTTATTCATTCAGAG
AGCCCGATGCGGGACTCGATCCCGGGTCTCCAGGATCACATCCCAGGCTGCAGGCAGCAC
TAAACCACTGTGCCACCGGGGCTGCCCGGGATCCCAGTTTCTAAGTTTAAATAATTTTTC
ACTTTAGCACTTGTTTTTGTACAATAATTTTTCAAAACAATTTTTAAAGATTTTATTTAT
TTATTCATGAGAGACACACAAGAGAGAGGCAGAGATGCAGGCAAAGGGAGAAGCAGGCTC
CCTACAGGACCCCAGGATCACACCCTGAGCTGAAGGCAGACCCTCAACTGCTGAGCCACC
CAGGCTTCCCTTGTACAATAATTTTTGTTACAATTTTTTTTGAAAAGGTAATCCACTGAG
AAGTTTTCGTCCTGTTCTTGCTTCTGTCCACTCGGTTTTCCTGCTCTCCTAATAAACACA
CTACCAGTTAAGTTTAAAGTAGGTAAGATGTAAAACTCAGCTCCTCAGTTGCACTGGGCA
CATTTGGAGTACTCGGCATTCACCGTGGCTGCTCTGCGGCTGTGTGGGAGCGCAGGGATC
TCACGGTCTCCATCTTTGCAGAGTTAGTTCTCTTGGACAGTGATGCCCTAACACACAGTG
GGCACTCACTGGAAAGGGAATTGTTCTCAATACTGAGTCTGTGCCGAGCACTGAGCTTGG
TGCTCTCCTTCCTCTCTTCTGTCCACGGATCCCCAGACAGTCCACTGAGACAGACACATC
TCTCATCCCGTTTTACAGAGGACACTGAGGCCCAGCGAGCGGAGCCATCTGCCCGAGGAC
ACAGAGCTGGGACCTGGAGGGAGTCAGCTAGAGACTGGTCCCTTCCTCGACCACGCAGCC
CCGCTCGCTCCCTCCCCAGGATCAAGGCAACGCCCGCCCCCAACGCCCCCAAAGCCAGCC
CCAGCCCCACCTCTCCCCCTCTGTACAAAGTCCTTGCCCCCAAGAAATTGTATATAAATC
ATCCTTTTCTACCAGCTGTCGCCAGGCCTGTAGATGGGACAGGATGTGGACGGGGCAGTT
TGGGTGCGGATCCTGGTTTTTCGGTTAATGCAATGCTTCATTCAGTCCCTGCTCTCTGAG
GCCGCCTGGGGTGCAGAACCAGTGCGCGGCAGCGCCGAGACCCAGTCGGGGGGAGTCAGG
ACCCGCCGGCCCGGGGCTCCGGATCTGAGGGGAACAAGACCCTGGGCGCCTCGGTGCAGC
GGCTGCAGTACAGGCCCTCGGAGCCCGCGGCGAGTACGCGTCCCGGCAGCCTGAGATCCC
GGGGGGCGCCCTGGAGGAGAGGACTCCTCCGCAGGAAAGCACTGGGACTGTGACAGTCTG
AGGCTTCAGAAGGTGGGGCTGGAGGGGAGGACATCCGAGGCCAGGGACGCAGCCGAAGCG
AAAACCTCGAAGCCGCCTGGTAGTCATTCCCTCGTACGCTCTTAGAGCTCAGAGGGCAAA
CTATTTCCATCTGTTTTACAGACGGGGACACTGAGGCCCAGACAGGGTCAGGCGGGGGCC
GGGGGGTGGGGGGGTGGGGTTCGGCCAAGTCACTGGGAGGCGGAACAGCCACTGGAATCC
AGACCTTTAAGCCTAGACTGCGCGATGAAGAGAGAGCCCACTGGCCCCCTGCGGGCCACC
GCGTGCCCTGCAACCTGCTGTCGCTTCAGCGAGTGACGGCGCTTCCCTCCGCTCCCCGCA
GACACCCGACCAAGCCCCCAACGCGGAAATTCGCAGCCCCTCAAAAATATGGCTGCCGAG
GCTGGACAGTCCCGTCCCAGCGGAGCCGCATCATACCCCACGTGATCTCTCGCCCAGCAC
AGCAATGGCTGCTTAAGAGCCGACGAGAAGGACTGGACGCGGATTGGACAGTTAGAAGAC
GACCCGCCTTCTAGCGGCTCCCTTTGCGCACGCGCAAAACACTCTAGCCAATGAAAAGAC
GGAAAGCTGCCCGTACAGCCCATGCGGCGTCACTTCCTCCGCCCCTGTTTCAAGGGATAA
GAAACCCTGCGCCGAGGCTTCCTCCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCA
GGTGCGGGCTCTTCGCGGGCCGGGGAGGCGTGGGGCCGGGTGGGTTCCAGGCCGGAATGG
GGTAGGGCCCTCTTTGCCCTCATAAGTGTGTTGTGAAACCTAAACTCGATAATTGAACGA
AAGGAGAAGCTTTCGGCCTAAGGAATCTGCAACGGGGAAACAGGAGATAACTAGGATGGC
TTCTTTTTGTTCGGGAATGGCTAAAATGCGGCATTACCCCTTTTCTCTTAGGGGCATAAT
GGGGGCTCCCAAAATAGAAAGCTACTTTAAAAGTAGGGCTCGTTTGTCTTCCTCTCGGCC
AAGCCTTGGCCGAGTTGGGCCCGTGTGTCCTTAGCGACGGAAAGCGCCTGGGCTGAGAAG
CCAAGGATTGGCCAAAATGGAGGGCGCTACCAGCCTGCTCGAGGCGCGCGTCCCCTCACC
CTCGTGGGAGTTCTCACCCGCCGCCTGCAGCTCTGGACGCTTTCGTAGGAGGTCTTAGGC
GGTGGGTCCAGAGCGTTCCTGCCTACTGGACGTCCAGGAACGAATTGCTCTTTTCGTTGC
TCCTGGAGCAGAGAACTGATGAAAGGCTCCGCTGCCCATGGCCACCTGAGGGACACCGCA
GAAGCGGCGGACTCCTTGTCTTGATTTTTTTAAATATGAAAGCGAGGATGGTTCCGGAAA
GGGTGTCCATGTGAATTTATGTAATGAGTCTGAGCGGTAAGGGGAGGAAAAGGCACGTTT
GTGGAGTCCGGAGAGGTGGTAAGGTTCTCTGAACACGTGTTCGCGCAGTCAACTGTGCCT
GGCACCATTGGGTTTATATTTAGTGTAATACGGTTAACATACCATAATGTTCCTGAGGCA
GATATTGTTATCCCCATCTTCCAGGTGAGGAAGCTGGAGATTTTTAGCCAAAGTCACATT
GTCAGGAAGTCTGGCTTTAGATTCTGTATCCTTCTGCCTTCCAACAATCACAAGTATATA
ACAAGCACTGGGTAAGAGTGGGGACTTGACTCGTGGTGAAGAAGCTAAGGATTTGACTTT
GAGAAGTTTGCCCAGGGATGCTGAGCTAAATTCGACATAAGATCTGGCACCAGCTCCTGA
CTACTCTGCAGAGCCTCTCCCACTGACTGGATCAATGGACAGACTGTTGCCAGCCTTTGT
TCAAATCCCAGCTCATCCTCTCACCCTTGAATGTAATTGGGGCTTAAGACTTCCTGCCCT
TTAGGCAGCTGAGATGTGAGGAAAGGCCTTTGTTTTAATTCTGTTCACGGAAATCGTGTC
AACCTTTGGTTTCTTGGCCACATCTGTTCGGTGGGCCTCGGGTCCTGGTTTTCAGGCCTG
CTAGTGGATAGGGCACTCTGGGGGATAAGGTGACAAACCAGCAGCACTAGTTGCTTTGGG
TGGGGAGTCAAAGCTGAAGATGCATCTAAGCCTTTTTATCCTATCTCCACCAGGTCCTGG
TGCTCGATGGCCGAGGCCATCTCCTGGGCCGCCTGGCGGCCATTGTGGCCAAACAGGTGC
TTCTGGGTAAGTCTGCTCTGCCCACGGTTCCTCTGGGCATGGGTCCCATCCAGCGGTCAG
TGATGAGCAACAATCACCATCTTTCGTTTGAGTCTCACGACCATGAGATCAACCCCATGC
ACCGCTCTGAGACCTACTAGCTACTCCCTCTCCTGGGGTCTGGGAGTTCGAGATGGAAAA
TTTTCAGTCAGGCTGTAAATATAAGCATAAATCAAGTTCTTCTTGGGGCAAGAGGTTCCC
CTGCAAGAGGCCTTGGCTTTCTTGTACGTTGTGGTCAGCTCCACACAGAAGGATCCATGT
TCCAGGGTCTTCAGGAGGTGGGTGGTAACCAGTTTATATGTAGAGCCGCTTGTAGCCTTT
GTTCGCACTTTCCTTTTCCTCTAGGCCGGAAGGTTGTAGTCGTGCGCTGTGAAGGCATCA
ACATTTCTGGCAATTTCTACAGAAACAAGTGTAAGTTAGGACCTGGGAGGAGGGCTGGAG
GGTGGACCTGGGAGATTCGCAGTCTTCATTGGCTCCAGGGGCGAGCCCACTGGTGGTGGG
AAGTGCTCATTTGCGTTCCCGAACAGGCCCTTGGGAGCATGGATGTGTGTTGGAAGAAGT
TAGCCTTTGGCTGGGGGCTGAGGTTTCACACCCTCTCTCTCCCCAGTGAAGTACCTGGCC
TTCCTCCGCAAGCGGATGAACACCAACCCATCCCGTGGCCCCTATCACTTCCGGGCACCC
AGCCGTATCTTTTGGCGGACAGTTAGAGGTGAGCGGGGCCTGAGGACTGCAGGTGGCGAG
GGGATGGGTGGCCAGTGATGAGGACTTCTCCCACTTGTATTCGAGTTTCCTGACTATGAG
ATGACTCCACATGCACTACCATCTGAGGCCACCACTGTGACCGTGGGGTTGGGTGGGGTT
GGGGGCAGGGTCCTCATGAGCCCCACTGAGCAAGTCTGTTGGTCATCCACCCACAGGCAT
GCTGCCCCACAAGACCAAGCGAGGCCAGGCTGCCCTGGACCGCCTCAAGGTGTTTGATGG
GATCCCACCACCCTATGACAAGGTGAGCTCCACAGCCTCCTGTACAGCATTCATGTGTCT
GGCGTCCATGATGTTGCACAGTTGTACCTACATTGTTTGATCCTCATGAGAACAGCATTG
GCTGAGACGCTGTCCCAGCAGCCTTCTTCCCTGTCTGTCCCTTATTCCAGGGCTCTTAAG
CTCCTCTCCTTCTCTAACAGAAAAAGCGAATGGTGGTTCCAGCTGCCCTCAAGGTGGTAC
GCCTGAAGCCTACACGAAAGGTGAGTTCCAGGTTAGGCTGGGTACTCTGACTAGGGGGCA
AATCTGAGGTCCCTGAAACTGGCAGATGATGGCTCTTTCTCACGATGGTCTGCGGATGCC
ACAGTGGGCAGTGCCGATAATGCCAATGGCTCAGCTGATGCCAGCAGGAGCAGGGAGCCC
CTTGGGGTGGCTGTATCTTTAGCTGAGACCTGCTGAGAAAATTTGGGTCCTCCAGGACAG
CTTGCCACCCTGGCTCCACTTGGCTTAGAACTTTCTTCTCCCCTCCCACACAGTTTGCTT
ACCTGGGGCGCCTGGCTCACGAAGTTGGCTGGAAGTACCAGGCAGTAACAGCCACCCTGG
AGGAGAAGAGGAAGGAAAAGGCCAAGATCCATTATCGGAAGAAGAAACAGCTTATGGTGA
GGATGGGCTGGAACCAAAGGGTACCGTGTTCTTGGGCAGGGCCTTGAGGATGATCTCTCT
GGACAGAGTGGTCTTTGTTCAGCCCCAGAGGCCTCTGCCTGAGGCCCGACTTGGCAGGGA
GTGGAATTGGGCACCTAGGATGAGGAAGGTCTTGGGCAACACCCATTGACCATTGTCTGT
TCTCTTACCCCACAGAGGCTACGGAAACAGGCCGAAAAGAATGTGGAGAAGAAAATTGAC
AAATACACAGAGGTCCTCAAGACCCATGGACTCCTGGTCTGAGCCCAATAAAATTGACTT
ATTCATCATGCTTGGCCTGGCCTGCCCTTCCTCCATCGCCGCCCTAGGATATGGGGGACT
CCCAGGGGCTGCTGCCCTCATGCCTCAGGCAACCTGGGGCTTACAGTACTGGGAACACAA
GGCTTTAGTCACTACTGTTAAGAAAGGTCTTCTAAAAAGTTAAAAAAAAAAATTCTTAAG
AGTTCTGAGGCATAAGTGCCTGTGACTCATTCCTGAGAGTTATTAGTGCCATTTCACTGT
AAGCAAGAAAGACCTGGAAAATGGAGGGGAGCCCTTCGTTGAGAATGGGGTGTATTTAAA
CTTGTCATGCACAGTCAGGCGCTATACTCTGTAGCTGTTAGGGTGTGAGGATGCTGGGGG
CCAAGCCTGGTGTACAGAGGTAGTTCCAGATCTGTAGATGGGGAACAGCCAAGGGGTCAC
AGGCTCTACCCTTGTGCTATCCCTGTAATTCTGTGATCCAAACCTAATAAATTATTTTTA
AAGAAACTTGGCGTCTTGCAGTGTGTGTCTGCTGTGGAGGCAGGCCCAGGGGAGTGAGGC
CCTCAGCAAGAAAAGGGGCTGGGAGGATAGGACTGGCCATGCTGGAGTCCTTCCCACAAC
AGTTGCATAATGACCTATTCTTCATGGAAGAGCTTCTGCCTACCAAGGAATTTTGAGTCG
TATGTAGTTGAATTTCTCAAAACCATCATGGTTGCCCAGCAGATTGTCTAATTCAGCTGC
AAAGTATGAAATTGTCACTTTTTAAAAATTTTATTCCTAACAACAAAAAAAATAATTTTA
TTCCTGAGAGGCAGGTTTCTCTACAAGGGGCCAATGTGGGACTCTTCCCTGGGATTGGAA
TTCTCAACCCCCCTCCCCGAGCCACCCAGGCGTCCCTAAATAGTCCTCTTAAAACCAGTC
TCATCACTGGCGGTTGGTCTTGGGCCACAGCAGGAGGTTCAGGAGACCGGAAACATTGAA
ATTAGCATTAGCCACGGAACTAGGAATATGAGATCTAAAGCTTTTATAAAGCTAGATTTG
GGAGGGGGTGGAGGGAGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1790..1900, 2176..2229, 2446..2589, 2936..3074, 6776..6960, 12953..13025, 13404..13469, 13666..13767, 13976..14061, 14240..14299, 14573..14695, 14895..15039
1001..1033, 1790..1900, 2176..2229, 2446..2589, 2936..3074, 6776..6960, 12953..13025, 13404..13469, 13666..13767, 13976..14061, 14240..14299, 14573..14695, 14895..14978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved