Canis_familiaris Locus Q9XSU4_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris Q9XSU4_CANFA
Canis_familiaris
Q9XSU4_CANFA
1
SNORD35
2459..2544
4813
aggccctttaaatgtggtctgtgcaccagtgccccatgctacaggataagtacacaaat
tgagagggagcatttggacactttgatagcaattctttatcagttgaatctataaacaaa
caaacaaaccttttttttgggggggggggaagagattttatttatttattcatgagagac
acagagaggcaaagacacgagcagagggagaagcagggtccctgcggggagctctatgcg
ggactccatcccaagaccctgggatcatgacctgaggtcaaggctgacgctcaacctcca
cccaggcgtcccagttaaatctaataacgttaaacagaaggcagcccgggggcctcagcg
gtttagcaccgccttcaggatcgagtccgacgtcaggctccctgcctggagcctgcttct
ccctctgcctgtgtctctgcctctttctctccgtgtctcatgaatacataaaatcttaaa
aaaaaaaaaaaaaacaaacactaaacaaagttaaaaattcaggtcctgtctcatgcgcat
ttccagtgccagctgcatccgtgtctgatggctcagatataaaacattctatcattgagg
gaagttctactggacggtgctgttacagacagaaaaccagcagaagggtttttttgtttt
ttcactaaaccattggggctgaaacagggcataaaggacaacaaacttcattaaacttga
aaaaaactcatggtcaatgccggcccctcacaaatatggcggcgccattgctcatgctcc
taagaccttccgaaaggccgccccgcaaaaagatggccgccaccacatcccttttggatt
ccgcagaaacacagccacgcggtccccctacccccacgtgatcttcactccaccgaaaga
tgcccgccttcctataattctcgcgataacgctggcctcgccttcccaacgtttactaac
ggacccagcgcgttcacggcttgactttctccagagggtgtCGGCGGGTCGCGGGCTCCC
GACCCGCGACCCTTCATCCTGTGCGGCGTCCGCTTAGTCTCCGAATCGAGTGCGGAGTTT
GGGCCGCACGTTTATCACAGTCGCGCCCGAGGCTCCAAACCGCGCTCCCGCCCCCTTTCG
TCACTTCCTCCCTTGCCCCTGTGCAGTCGATAAGGAAACCCGGACGCCCTTCCGGCTTTC
CTTTTTCCAGGCGGCCGGGAAGATGGCAGACATTCAGgttcgtgctcggggccggcgcgg
atgcttcgggacccacccccggcctcaggggcgcgtccgggagagaaggacgcccgatcc
ccagcgtggggttaatcccaggcagcctagacaccccaggccttaatgcgggagcgcgtg
tgtttgaattaaactacgttagcgcctcctaaatcccgggggctccccttagtggaggct
caaacctcttaggagttattttcttaaaactcaaggtttacggggtggtttttctggagg
ccttgggccatcgagttaatcctgttagaacggagccctaagggctaatccagggagccc
cgggtttggtatttatttctgaagtcgcctacgttacgtaaggagagaattctggggggg
tgtccttatggcttggagaagaagcattgctgtaaggtgtccaggttagaggagtgattg
tgcctgggttttaaggaatgacttctgcaggtgatgggacgtatttgggtgcacaaatgc
tgaagtaattctggctcataattcggactccgctcaatttcagggagtgttttagatggt
aattatccaggctcgggaggctgccgtttggggaccaaatgctggagaggatggggtcgg
ggtttctgggaaggtttccaggccaggttgcccgccccaagctcaccagcttcctccttg
tccacctagACCGAGCGTGCCTACCAAAAGCAGCCAACCATCTTTCAAAATAAGAAGAGG
GTCCTACTTGGAGAAACTGGCAAGGAGAAGCTCCCGCGGTACTACAAAAACATCGGTCTG
GGCTTCAAGACGCCCAAGGAGgtatgggggggacggtattctgggaaggaaggagacccc
tgtaccccagcacacgtgtgcccagaccgggttaccctgctggcatctgagtgactgatc
ctggggctgatgggaattgtagttcctgtccctgagcaccaccacccccgcggtggtttc
aggaacagcttgttcagggctcactcctttttctcccttactcagGCCATTGAGGGCACC
TATATTGACAAGAAATGCCCCTTTACTGGCAATGTCTCCATCCGAGGGCGGATTTTGTCT
Ggtgagtgaaggctctgggagcttgggttcagatttttgggtctgagggaggatggactg
gggatgctcagattcctgggtgagggggagttggcagctttctgggtccagagggcactg
gcagatgatgtcttttcacgatggtcttcagatgcccaccgcgggcactgctgaaaaaac
cacttggcacagctgatgtcagcggggcttgggatccctccttggcagctcccaattccc
agcatgctctggaagtgcccaaggctccccttccccaggggctgacctgcaatccatgcc
ttctccccagGTGTGGTGACCAAAATGAAGATGCAGAGGACTATTGTCATCCGCCGAGAC
TACCTCCACTACATCCGAAAGTACAACCGCTTTGAGAAACGCCACAAGAACATGTCGGTG
CACTTGTCTCCTTGCTTCAGgtgaatatggtgggccctcaggttcccaggccaaggggaa
agaagtggtctttccccgggtctgagggacatggaacctggcttgggttgacagggctct
ctggctgctgtgtgggtagtaaactattgggagacagtgtgaggagactggtgtgaccaa
gcagataattctcaggagcctccagtccgtgtaaagtggaggggattgagagagggtttc
ttttattaagattttttatttattgggatccctgggaggcgcagcggtttagcgcctgcc
tttggcccagggcgcgatcctggagacccaggatcgagtcccacgtcgggctccccgtgc
atggagcctgcttctccctctgcctgtgtctctgcctctctctctcactgtgtgcctatc
ataaataaataataaaaaattaaaaaaaaaagattttttatttatttatacatgagaaaa
gcagagggagaagcaggctccacgcagggagcccgatgcaggactcaattccaagactcc
aggatacaccctgggccaaaggcagatgctaaaccactgagccaccagggatccctgagg
gagggcttctaccctgagaagtcgccaaaggggctggagtattctctgtagagctttgag
tttgatatcttgcacagagtttgtgtccaataaataacgacccagggaggggatggcagg
tggaagtggaaagtggagcgtgggtagggtttagtggagccaaagcagaggcctcagcct
ttagtggcctgcgtgggacagtccagcctgtgacagcctctgcccaactccacagGGATG
TCCAGATCGGCGACATTGTCACAGTGGGTGAGTGCCGCCCTTTGAGCAAGACTGTGCGTT
TCAACGTGCTCAAAGTCACAAAAGCTGCTGGCACGAAGAAGCAGTTCCAGAAGTTTTGAG
GCAAGACTTCTGTCTACACCCCTGAAGAAAATAAAACTGTCTACACCCCTGAAGAAAATA
AAACTGTCTACACCCCTGACTCCCAGGTCTCAAAaactattttcccagttttgggcttgg
cccagtgtacctgtacttttgctagagggaattttttttttttttaagatctcatttatt
tattcatgagacagaggcagaaggagaagcaggctcctcgggggaagcccgatgtgggat
caggactccaccctgaaccagagatcattccttgagctgaaggcagatgttcaatcgctg
agccacccaggcatccctttgctagagggattatttctgggagttgaatggggttgatgc
aaaagatggggttttctttcatcctctggacccccatataagggtggggctggctgggtg
ctgcctcctttctgtcttttcatctctgaagataggaacctgtattaagacactgctcct
tctttgggtctccttttgatccacgtcacatcttggtgtcagaataagtaagcccttcta
cctggtgttggggcatgccctcaactcccccagtctctggggaggaagtgagtgagggcg
taggctcctgcgttctctctctcaactctggtgtaagccttcttgcctccttgggagggt
gaaggagaagcagccatctcagcccagctaggggcactgaatgggcttgcagggttctgt
gctgtctggtggggtcttaatcttcaacctgggctttcctgtctcccctgacagtggagg
agtgcaccagggaagccagacagccagcctctccagccccagcacacacccccacccctt
ccccttcctgagcaagcaccagtctccttggcaaacccatctgaggggacaggttctccc
gtccgtgaggagctgagctctactggtttcctttgcctgaaaatccaaggaaattggctt
tgaaggcacgtcacatagtgaagccaagctggagccagcctgggacccacctctgtagca
cctgattgcaagctgctcagaagtaggttagaaagaccctggaagtgagacttcccagcc
ttggaagcagagag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1236, 1929..2060, 2265..2340, 2650..2779, 3595..3813
1222..1236, 1929..2060, 2265..2340, 2650..2779, 3595..3718
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved