Canis_familiaris Locus TCP1
snOPY snoRNA Orthological Gene Database
Canis_familiaris TCP1
Canis_familiaris
TCP1
1
SNORA29
3974..4113
10580
AGAAGCACTGGTTCCCCGGGGTCACCGACGCCTCCGCCCGGAACTGGCGAGCCGGGTCG
CCGAGTGGCCGACGGAGCGATCAGTCACCTCGGCTCCTCCAATCACTGCCCACGCAGAGG
CGCACGCTACGCTGGAGCCCGCCAACCACCTCGCAGCACCGCGCGGGGGGCGGGGCGCAG
CTCGCTAGGTCGCGGGCGGCGTCTCGCCGGACCGGCAGGCGCGAGGCACCCGTAACTTCA
CGTTGCCTTATTTGGTCCTGCGGTCGCAAAGCGTCTGCCGACCGCGGTCAGATCCACACA
CGGCCCCGCTGGGCAACGGGAGGAACCGGCGCAGCGCAAGATGCAGTTTCTCTCCAGAAA
CCGTGGTGGCCATTTTCCTCGTAGAAAGCACTTGGCCCGTCCCACCCAGGTTCAGGCCCC
CAAGCGTATGCTCGTGGGCTCGGAAGTCAGCCCCGACTCGCCACGTTCTCTCTGAAGACC
CTTAGGGAACCTGCCGAACTCGCTCAGGAGTGCAGCCGAACCGGGAGAGGCCCGCCCTCT
CGTCACACCCCAACTGCAAGCTCCGCCCCACCGTCCACTTTTTCTAGAAAGCACTAGAAG
GTGCAAGCGCGCACGCGCAACCCGTTCCCGCAGGAGGGGAAGAGAAGCCTCAACCGTGCA
CCTCCTTCCTCCTCCAGTGCGCGATCCTGACTTCCGTTCTCCTGCCTTCGCGCCCTGCTC
ATTCGCTCTCTAATTGGGCGAAAGTGCTGCTCCCGCCTTCTCCCGCCCCCTCACTTCCGG
CTCCTTCGCACTCTCGCTCCCCCCGCCCTTTCTTTCCTTCCCGCCCTGCCCCGCGGCCCG
GCCGCGGCAGCGGTGTTCCCAGCAGCCCCCGCGGCCTCGCTCGGCCCCGTTCCACGCCGT
AGCCGCCGCCGCCGCGCTGCAGTGGCCGCCGCCGGGCCTAGGGATCCAGACGCTGGTTGC
CCGCGGTCAGCGTGAACCTCGACGTGCACCCCGCCGCCAAGATGGAGGGGCCTTTGTCCG
TGTTCGGAGACCGCAGCACCGGGGAGGCGATCCGCTCCCAGAACGGTAAGCGCGAACGAG
GCCTGTGCCGGGCGGGCCCACGGCGGGGCGGGCCCCCGCCCCCAGCCCGCTCGGCTCGGG
CCGCCACCGCGCCCCTTCCGTCCTGGAGGGTCCGGGATGCGCCTCGCGGGGCTCCCCGGG
GCGGGGCGGGGCGGCAGCGCCCTCTCGCCGTCCGCAAGGCGTTGCGGAGAGCCCCGCACG
TTTGGGGGCACAGCCCTGCCGATTGTGGTCGGCAGCGGATCCCCGGGCCCTGGGCCGCCC
AGCCCTGCAGTGACACGTGCCGTCACGCCTCGAGTCCCCTTTGGGCCGGGCGCCCTGCGC
CTCCGATTCTAACCTGCAGGAGCGCCTAACTCCATGTTTGGGCCTCGTTTTAGGGCCATT
ACCCAGGAAAAGACGAGCTTTAACTGCTCGCTCTCCTGATGAGCGAATGGCCGCGACCCG
GATGTCTTGCCCGTTGTAGAACCTGCTGGTTCGAGCCTGCGGTGGTAGCCGCCGGTGCCC
GCGTCCAGACCCAGTTCTTTGCACGCATCGCTGACAGGTTCTTACCGTACGGTTGACCGG
CGAAATTTCGGTTGAACGTTCGCGTGAGTGGTACTTAGGACGAGTTCATCCTGGCAAACG
ATACGGATTCACACGTTTGCTGCAGTTAAGCCTCTTTTGCAAGCGTGTTCGCTTTGAAGT
CATGGATGCCTGCCCATCTTACCCTTTTAAGTATTTCGGATTGATTTGTATATTTGGAAA
ATGCAAAGGCTGTGGCTGTCACTTTCTTTAGGCCGAAATGAAATGGCCGTCATTTGGAGC
AGTGGATTTAATTTTTTTTTTTTTCTTTTTCCTGCAGTTATGGCTGCGGCTTCTATTGCC
AATATTGTAAAAAGCTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTTGATGATATT
GGTGTAAGTACACCTACATGTTGTGTTTGTGACTTTAACAAAAAATAACAGTGCTTAAAT
ATTTAGCGCCATGAATTGTTTTTATCACAATGCTGATAGCGAAAGGTGTTGTTAAGGGGC
TGGTGGGCTTGTGTTCATTTAGAGGAGGTTCTCTGTTTGTAGTTGATTGTGTTGTCTTTT
TTTCTTCCCTGCAAATTCCTTAGGATGTAACCATTACTAACGATGGTGCCACCATCCTGA
AGTTACTGGAGGTGGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCAGATCTGCAAG
ACAAAGAAGTGGGAGATGGAACTACCTCAGTGGTAGGTAGTTTGTCACCTGCTAGATCGC
TATAGATTAGTTGTTTTCCTTTTTTTTTTTTTTTTTAAGATTTTATTTATTCATTTATGA
GAAGACAGAGAGAGAGAAGCAGGCTCCTTATAGGGAGCTCTATGTGGGACTCTATTCCGG
GACCCGGGATCAGGCCCTGAGCCAAAGGATGACACTTAACCAGTGAGCCACCCAGGAGCC
CCTAGATTAGTTGTTTTCCTAAAACTGAACCTTGACAAAGTGCAGCCAGAAGTAAGTCGT
TTGTTTCTCAGTCAGATGAGGTACATACTTGAGAGGGAGAAAATTTAAGTTGGGATAGTG
ATTTAGAAACAGAATTTAAAATCAATATTTACTGCTAGTTTGTAGGATTTAAAGGAGAGA
AGCTTAAGAGGTAATGTAGTACAGTCATTTTAAATGTGAGTTTTCAAATGGTTTGTGAGT
TTTTCAGCTACAACAATATTTATACATCACATACAGGGCTTTTGTTTGTTTTATGTTCTG
TTTCCAGGATGTCTGGGTAGCTCAGTCAGTTAATCGTCCAACTCTCGATCTCAGGCTCAG
ATCTTGATCCCAGGGTTGTGAGTTCAAGCCCCACATTGGACTCTACATTGAGTGTGGAGC
CTACTTTAAAAATTTTGTTTTGTTTTCTCCTTACTACCTGAAACTTAGAAGTTCCTAAAT
TCTTAAGTTAGGGGAGAAATGTTACTGGGCTTTTTTTTTAAGGTGTTTTTATATTAAATC
CTGATAGGCAAACTCCTAAGTTCAGAATGATAAGGAACAAATAATTTGCTGTAAAAAAAA
AAAAAACAAAAAAAAAAACAGGCAGTGATTTGCAGGGAAAATGTTTATATTTGTAGATTG
AACTTCAAACCATGAAAGAATGGAATGGAATCTACCTTTTCTGAAATAATGAAAATAGTT
TAAGTAACTTGTTTACAGTAATATGATTTTTAAAATAAAGTGATTTTAATTTTCCCTAGA
AGAGCCAGACTGAATTTTTGATTCTTTAATGTCCTTAGAAGAATGATTTTTTTAAAGATT
TTATTTATTTATTCATGAGAGAGGCAGAGACATAGGCAGAGGGAGAAGCAGGCTCCATGC
GGGGAGCTCAGTGTGGGACTCGATCCCCGGTCTCCAGGATCACGCCCTGGGCTGAAGGCG
GCGCTAAACTGCTGAGCCACCCAGCAGTCCCCAGAAGAATGATTTTTAAAGTAAAAAAGT
AAACCAAGTAAAAATTTAAAGTAATAAAGATTATCGGAGTAGTAGACTTTTTTTCAGGTT
CCCAATAACCAGTTATTCACCATCATTGGCACTCTGATTAATTGTAGGTAGTCATTTTAG
TGCTGTTTTTACATATGTGTTGCACATATTGTCAGACTAAAAGCAGTGAATATTTTCTCA
ACAGGTTATTATTGCAGCAGAACTTCTTAAAAATGCAGATGAACTAGTCAAACAGAAAAT
TCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGTAAGATTGTTTGCATTC
AGAGGAAATTTTACATTATGTGATGTTATAGTTGTAAATAGTCTGTGTTCTTTAAATGTT
AATGACTAAATTTTATTTTGAAAAAGTGCTATTTTAGTAATAATATCTGGAGTAAGAATA
AGGCTAGCATCTTTTTTCCCATTTGACTACCACATTTTCTCCCAATAATAGATTTTGGTG
GCTATGCTTATGGGATAGATTAAAATTGCCATGATCTGAAGAGGGAGGATTTATTTGTGT
CCTCCTCCTATATGAAATGGCCAAACAGAAAATTGGTGCCTAAGATATTTTGACACTTTG
GTAAAACAAAGTTTGAGTAGTGCATTTACAAATGTTTTCTCCCACACACTTCAAACAGGG
AGGCAGTGCGATACATCAGTGAAAATCTGATTATTAACACAGATGAACTTGGAAGAGATT
GCCTAATCAATGCTGCTAAGACGTCGATGTCTTCCAAAATCATTGGAATGTATCCTTGTG
ATAAAATCTTGGTTAGTTTTTATGCCGTGTGATACTGTATTAAAATTGCTCCCTTCCTTG
ATTTTCTAGGGGGAGAGATGATAATAAAGTGTGTAATAGTACTATGAATTTCAAGTAGTG
ATAACTCCTGCGTTTTGATGGAGTTTTATTATTAATGCTTGTTTCTTTGATGAATTGCTA
AAAGGAAGTGCCTTGGATTACTCTTGATTTTTGTGTGCACCTGTTCATTCCATGTCTCTC
CATGTTCCCCTTAACCCTTGTCTTAGAAATGGTGATTTCTTTGCCAATATGGTAGTAGAT
GCTGTACTTGCGGTTAAGTATACAGACGTAAGAGGCCAGCCTCGCTATCCAGTCAATTCT
GTTAACATTCTGAAAGCCCATGGGAGAAGTCAGACAGAGAGTTTGCTTATCAGTGGCTAT
GCACTCAACTGTGTGGTGGGATCCCAAGGTAAGGCTTAGGATTTAGTACTAAAAGTGAAA
ATTTGCTTTTTGTGGACTACTTACTTACTATACATCTTTCAGGTGGGCTATCCAAGACTT
GCACCTACTTTTCTTCAGTAAAGCCCAGAGTAAAGGAAATCGTATATCCAGGTTTCCGGT
TTCCCTTGTGTAACTTAGTACATAAAACTTAGGAGAAGTGCAATGCAAGTTAAAATTACC
ATTACGTGTGGTAATGGCCCTAAAAATTTGTTTGTAGAGTTAAATATAATAAAAATGTAA
GTTTTTGTCTTTAAAGATAATTTAATATCTTTTGCTACTTTTGTGCTTAAGAATAGGTGT
ATTTTATAAGATGTGACATTGTTACAGTTCTTATAAAGGTATTCAATGTGTTCAATTATA
GGCATGCCCAAGAGGATAGTTAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAGAAA
ACAAAAATGAAGCTTGGTGTACAGGTGGTTATTACAGACCCTGAGAAACTCGACCAGATT
AGGCAGAGGTATGTTTAGATATTATTTTTGACTTTTGGAAAAGGTGTTTATAAATTATGC
TTGTTAAAGCAGGTAACAGTAAAGAAGTACACCCAAAAGGAGCGGGGCACTGGGGTGGCT
CAGTGGGTTAAGCGTCTGACTTGTCTGACTTGGGCTGAGGTTCGTAATGGCATGGTCTTG
GTTCTAAAAGGGAGTTCATGGACTCTGCTCAGCAGGAAGTCGGCCTGTGCCTCTGCCACC
GCCCCCTCTCATGGTTGCGCGCTCTCAAAGAAATACGATAAAATCTTCTTTTAAAAAAGC
ACATTATACTTTCTAGAAAACAGCAAGTAAACCAGTTGCCAGGTAGCAGAGGATGATGAT
GATGCAACTGGATTTTTTTAAATGTGGATGTAAAAAACAGTAGTAACCAAACCTATAAGA
AATCTTTGCCAGGAGTCAGGCATGCTTTTTCCTTTTGGATCTGCATGTGTGCTTTTTTTC
ATTCCAATAAAGTGTCCTTTCTTCCACCAAAGGTCAGGCTCTAGAGTATTATCAAACTGC
ATCTTCAATTACTAATTCTGTTTCTCATTCCTTTTCTAGATTCCACTTGCAGCCACTTTG
TAGCTCTCATACCCAGAAATAAAAGCCTCCTGCTCCAGTTACTCCGTCTTTCCCCATCTC
TTCACAGCTGGACGTCCTGGGTTTTTGTTTTATTTTGCTTTGTTTTTAATTTCACAAAAT
CCGTTTCCTGGTATTTTCCTTTCTCATTTCCTTTTCATCTCTGTTCTTCACTGGAGGGAC
CATTTGCAAAGGGCACTAGTGGTCCCTAGTGTAAAATTCACTAGACACTTAACAACCTTC
GCTTGTCCTTTATCAAGCTGTTCGTTACTTCCTTCTTGAAACACTTGGAAGAGGCGGGGA
TGGGCTTTGTGATACAGCCCCATCTATATCTGTATGCCAGAGTAACTCCTCCTCACTCCT
AGGACATCAGATAATATCTCAGTGCTGGACACTTCCAATTCTGTTTCTTTGCACTCCAGA
CACCTGTGAATACTCCTTATGCATCTCAAAATCAATATTTAAAACTGAACTTCAGGGCAG
CCTGGGTGGCTCAGTGGTTTAGTGCCGCTTTCAGCCCAGGGTGTGATCCTGGAAACCCGG
GATCAAGACCCACATCAGGCTCCCTGCATAGAGTCTGCTTCTCCCTCTGCCTGTGTCTCT
GCCTCTCTTTCTCTGTCTCTCATGAGTAAATAAATAAAATCTTAAAAAAATAAAACTGAA
CTTCAGGTGGTACCCATAAATCGACTTGTGCTATTTTAGTGATGAGGATCTTCAGAGAAA
ACTAGGAAATATCTTTAATGCCTCTTTATAGTTATACCTTTCTCTTTTCTATTTATCTTC
AAATTAAATCTCAGCTTCGTCTACTTTTCATTCTCTTGCCCAGACTGTTGTAGAGGAAGC
CACGCTGGTCACCTGGGTTCACTCTTGTCCCCTCCCAGACTGTTTTCCCCACAGAAGCCA
CTTCATCCTCATAACTTCCAAGTCCAGAGCTTTATGTAGGTTTTTCATTGCTCTGCAGTA
GGTGTTTTTAATTTCTTATATATCTTTTTTCACTGTGGTCCAGCAACACCCAGTACTAGG
ACTTACCAAACTCTTCCCCCGGTTGCTTCAGTAATGTTCTCTCTGCCTATGGCCTACTCT
CTGCTTGTTTGGTCTGATTAATTTTTTACTTGTTTTTTTTAGCTAATCAATCTCTCAGGC
TTATTTTTCTCCTTTAATCTAAATCCTACTTTACCATGAGTTCCTGTACTTGATCTTCCC
GGCCCTTAAGCAGTTTTTGTGTGTTTGTAGGACTTCGACTAACCGCAGTTCTTGGTTAGG
AACTCCCATTGGGATTGGGGGGGAACCTAAGTAGTAATTTTAAATTTCTTTGCTTTTTCT
GTAAATCAATTTAAATTTTGGTCACAGAAGGGAAAGAATGTTTGATATAATTTAATGTGC
AATTATTTTGTGGAAAGTACTTAATGGAAGAACTAGATTAACAACATAGAAGATAACTTT
GGGTTATTACCCAAATACTTCATCTCTGTAGAGAATCTGATATCACCAAGGAGCGGATCC
AGAAGATCCTGGCAACTGGTGCCAACGTTATTCTAACCACTGGTGGAATTGACGACATGT
GTTTGAAGTATTTTGTGGAGACAGGCGCCATGGCAGTTAGAAGAGTTTTAAAAAGGGACC
TTAAACGCATCGCTAAAGCTTCTGGAGGTAGGGCCTCTGCTGGCTCCCGGTTGTGGTGTG
TCACTCACTATACCATTTACACAAACGTGTGTCTTTACATTGGAATGTCCTCACTAAGCA
GCTTCAAAAACATTAAGTTTTTTATTTTTATTATTCTCCCAATGCTTTGTGCTACAGATA
GAGCCATTTTTCATGTTACTGGGAAAGTTTTTTAACTTACTGAATTTTTTTACATCAAAA
AGACATAGTTTCACGTTAGGATAAAAGGACTCAGTGGTTTGTCTCATGCTTAACTGTAAA
CCTTCGATTGTATCTATACATTGCTTTTATCAAATGTTTCTAAATCTAAGTCAGGATATG
AAAACATTCATGGGAAAACAGTGTTTATAGGTGTTTGTCATTATCTTAACAGCAACTGTT
CTGTCAACCCTGGCCAATTTGGAAGGAGAAGAAACTTTTGAAGCTTCCATGTTGGGACAA
GCAGAAGAGGTGGTACAGGAGAGAATTTGTGATGATGAACTGATCTTGATCAAAAAGTAA
GCTGCTTTCTAAATTACAAAGCTGTACAGATTTTATTAATGAGTAGAAATAGATCACCTT
CCCATTGATTTGCTGCTCTAGTCTTTCAGTGATAGGAGCAGTTATACGCATGGGAGAGAA
CAATGTTAGGCCATGGTAGATAGAGATGGAGTAACCATTTCATCTCATCTGCACTGCCCA
GACACTGCTGCTCTGTCTGAGTGAACCATGTGAGCAGGACTCAAGGTGCTTGCAGTGAAT
TTCTACGTAGACTAATGTTATAAAATATTGACATAAGAATTCTACTTTATTTTAAATAGC
ACTAAGGCTCGTACGTCTGCATCAATTATCTTACGTGGGGCAAATGATTTCATGTGTGAC
GAGATGGAGCGCTCTTTACATGATGCTCTCTGCGTGGTGAAGAGAGTTTTGGAGTCCAAA
TCCGTGGTCCCAGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAGAACTAT
GCAACCAGCATGGTAAGAATATATAGAAATGTGGTTTCTTTGTTTTTCAAGAAGGGCATG
GGACCCCATCTTTAGCATTTGGTTAGTCTACCTTGTCTGAGACCAGTGCTGCTTTGTGAA
GACTGTTCATTGTTTGTTCTCAGGGGTCTCGGGAACAGCTTGCTATTGCGGAATTTGCAA
GATCTCTCCTTGTTATTCCTAATACACTGGCAGTTAACGCTGCTCAAGACTCCACAGATC
TGGTGGCAAAGTTAAGAGCTTTCCATAATGAGGCTCAAGTTAACCCAGAACGCAAAAATC
TAAAATGGTAAGCTTATAGTTGCCTTGTCTTTTTCCCTGTCATCTGTGTATCCTATATGG
TAGTTTAGCTTTGTTTTAAATTTAAGAAAGGTGATGGCTAGTGCTTACCTCATGTTAGCA
TGTGTTAGTTAGCACTTCTGGTCTCAGCCTCCCTGCTTCTCTGGGTAGTCCCTGCACCTA
CACAGATATCTCACAGAGGCAGAGGGGGGATTATTTTGGGGTGATCTGAATCTTCTTAAG
CAGTCTCTTTCAGTGATGTTTAGAAACATCTTTGGGATCATCTAATAATCTTTCTATAAT
TCTTTTCAGTACTGCTAACTACTATAGTCTTAAAGGCTCTACTGTAAGGTCCCAAGGTTT
CCCAGGATTCACATTTGAGTGGAATGGCTGGATTCAAAGAGCTGGAATGGGATAGGTATA
TGTTATCTAAGAAGCCACTTAGTTTTTTTCCTAAATTGCAGGATTGGTCTTGATTTGATC
AATGGTAAACCTCGAGACAACAAGCAAGCAGGGGTGTTTGAACCAACCATAGTGAAAGTG
AAGAGTTTGAAGTTTGCAACAGAAGCTGCAATTACCATTCTTCGAATTGATGATCTCATC
AAATTACACCCAGAGAGCAAAGATGACAAACATGGAGGTTATGAAGATGCCGTTCACTCG
GGAGCCCTTGATGACTGATGTGCTTTCTTTTATTTATAACAATGTTGGATGCAATTCTCT
TGTTCCTCTAGTATTACACATTAAAAATAACAAGCTGTCAAGCCTTGGGTTCTTATGAAA
GATAAGTTTCCATCCTTTTGGTCCTGTGGTTTCATACACTGTAACTTAGTACCATATTAG
CTTAAAAAGAGATTAGGTTCCAGTTGAGTTCCAACACAGGTAATTGTTAAGCAATTTCAT
CCTCTCTGAACACACATTGCTATGCCCATCCCACCCCCTATGCACAGGGCAGCAACACCA
CGGTGTCCACCCTTTCGCTCCATTGTGTGTAACAGGGTAACAAGAATCCGACAGCCAGAT
GCTCCAAGAGGATGGCCCAAGGCTATAGCCCCTCCTTGAATGTTGACCTAAGAGGGAAAA
GATATATATCATTTATTTTGTGGACATCAGGTAAAAATCCCGAATTACCCTTCCCTTTCT
AATGTTCCACCAGGAACTATCCTTTCAAATTCTACTTTGATTTTAAGTGCTTAGGAACTG
AGACACCCACCCTACCTTACTAGTTTAGTCAAAATGCTCTGTTTATGTCAAAAGTAGAAA
AACAGTCCAGGGGTTTTGCCTTAGGAAACAGAGTAACTCCTGAGTCCCAGAAGGAGCTTC
CCAGTGTCTGCCTCTAATAGTATGGCCTGTACCTGGGTTTTGCTATTTATAATCAGATTT
GCATTGCAAGCTGTCCTCAGGACTGCTTGCTCAGGTTTACCTTCTCTGGGTTTAATCCAA
GTTCTTTAGTTATTGCAACAGAGAGGGCTGCAAAGGCTTCGTTGATCTCAAATATGTCCA
CATCCTCCAGGGACCAGCCTGCTTTTGCAACCTAAAGGAAAGATTAATGGATTAGAGTCC
TAAAAACTTAGATGAAATCTATTCTAGATACTTGAGGATCTCACAGGTTTTTACATGAGT
CTGGTGATACCACGTTTTGCCTTGGCTACACCAATTCTAAAATGTTAAGGATAAAACATC
TGGGTTCCAAAAAAAAGTTCTGAAGCCGTAACGTACATGTACATGTGGTGAGATGATCTA
GGTGATTTAGCAGTTCCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 1897..1982, 2183..2311, 3724..3821, 4198..4308, 4586..4767, 5161..5287, 7351..7526, 7912..8035, 8339..8531, 8663..8826, 9281..9580
1001..1064, 1897..1982, 2183..2311, 3724..3821, 4198..4308, 4586..4767, 5161..5287, 7351..7526, 7912..8035, 8339..8531, 8663..8826, 9281..9494
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved