Canis_familiaris Locus RPS12
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPS12
Canis_familiaris
RPS12
1
SNORD101, SNORD100, SNORA33
1654..1727, 2845..2921, 3257..3386
4607
TGGCTTGGAGACTTGCCAGGAGAGGAAGTTAAGAAAAAGAGACTGATGATACGCAGCCG
TATTCCATATATTTGCATTTTGAAATGGAGGTAGTAGGGGTTTGGCTGACATGTGCAAAA
TTCAAAATGTTGCCTGCCCCTGGTTGAAGCCGGGTTCCAGGGCTCTGGGATGCCCCCTCT
AGCTCCGCCCGTCCTGCAGGCCAAAATCAGGCGGGATTTCTCCAAGGCTCGGTTCTCACC
ACTACATTCCGGTCCTGGGTCGGGCACACCGTGGGCGTATTAAATGCACCTCCTGAATCC
TGATTCGCGCGGGATGACGAATTTAGGGGACGATCTACCGTGAAAAAAAGAAAAAAGAAA
AAAAAAAAAACAACTTCATTTAGAACCAACTACCTTTAGAAACCGTAACCAACCACCTGA
GGTTCCGCTTTACTAAACACATCACCGGTGAAGCGGAATTTGCCTAGTGCTTCGTACCGA
AAAGGTGCTGGCTTTTCGTTTCCCAACAAACCAGGATCGCCTCCAAAACGACCTTGAGAG
TGACTGAAACGAGAAGGGAGGGCATGCGGCGCAGGAAGGCCCAGTTGGCAGGGGCGACAG
AAAGTCACAGCGCAGCGCTGCTGACCTAGGTTGACACTGACTGCGGAGCTCGAGCGCCGC
GGGAGCCAAGCAGGCGGCGCAGGAGCGCGCTGGGCCTCCTCGCGCTCCGTAGGACGAGCC
CTCTGGGCCTCCGTAGGCCACGCCTCCGGCGGGGAGGCCGAGGCGAGGCTGCCCGCGTTG
GTGCCTGTTCCGCGTGTCAACGACCGGCCGCGCAGAGTCGGAAGACTAGGAGTGCTCCGG
CCTCAGAGCCGCCTCAACCCGGAAACAGAAACTCTCCGGCCTGGCACCACCAGAGCCACC
TCCGTCAGGAAAGGCAGTGCACATGCGCGCAGGGGGCCCTGGGCAGCCCTTAAATACCGT
CATGCGCGCGCGTGCGACCTCTTTCTCTGCCGCCGCCGAGTCGCGCGGAGGCGGAAGCTC
CTGGTGAGTTGAACGAGGCGGGGGTAGTAGTCTTGCCCCTGCTGCTTCTGGCCAAGGTTG
GGTTTCGGCTGATTTGTTTAGTCATCTGGTGTTTTTGTTTGTGTCTACGTTATAGTGCGG
TCAAGATTCGGCTACACTCGTAATCCACCGCCATGGCCGAGGAAGGGTGAGGCCGGGGTG
CCGGGGTCGTGGTGCGGGCTCAGGGTGGGCCGCAGCGCCCCGAGGCCACCTCGCAGAAGA
TTGCGCGGAATTTGCTGGTGGTTTTGACTTGGTTTGGTGCATTTCAGCATTGCTGCTGGA
GGTGTAATGGACGTTAATACTGCTTTACAAGAGGTGCTGAAGACCGCCCTCATCCACGAT
GGCCTAGCACGTGGAATTCGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTATCAGTCT
CAATACTGTGGGTTGTTGGAACCGGAGCAAAACTGCAGCCAAGGGAAGAAAGCGTGAAGT
TCATGGTGTTAGCACAAGAGTTCTGAATGACATCGTCCTACAGGAAACCTAGGAAAAGGT
ATCAGAACTCAGATATGTATAGCCCCACAAAGTTCGTGGGTTCCTGTTTCCAGTGGGAGT
AAGCATTTGATGTTTCTTAGCCAAAGACTACAGCGTTTGAATGATGACTTAAATTGTCGG
ATACCCCTTCACTCTCTCGATGAGTGAAACATGAACAGTCTGACAAACCTGTAGGTTGTG
GGACGAATCACACTTGAAAAGGACAGCTAGGAGTCCTCATTTGGCAGTTTGCAAAAATTG
AAGTATGAAGTTAGGGAATTGCAAGCTATTGTGGAAGTAGCCGGATTGTTGGGAGAATTC
AGAAGGTAGTAGCTGTAGAGGTGAACACATGAGAAATAATTGTAAATAGATCTGCTTAGT
TTTGGGGCTAGAGACGTTGGCCAAAACAACTGCATGTATTAACGATTTGAGCTGAATTTT
AGTGCACTTTAAGAAGTTCTTAAGTAATTTTAAGGCTGTTCAGCTCACTTTGGTGTAGAC
TGGCCACTTGAATCCACTGAAAAGAACAGTTGGAAGCCCTTCGAGTCCTGGTGTGACTCC
CCTGCAGTATTTGTACAGTGATGGTGCTGCTCGGTATTGTGTTCCTGGGCCAGTAACCGG
TAACAACTCTTAAGCGTGGTTAGTTTCATACAACAGCTTTTAAACGCGTAATTGGCTTGC
AAGAAAGGATGACAAAAGTTTGTGAACTAACGGTACATAAACTTAGTATTGGGGAGTTAC
TGAAAGCTTGATCCTGTAGATGAACATAGGCTCTTTAACAGGTTCCGCAAGCTGAAGGAG
TTGTATCTTCCAGTGGGTGTTGCTTGTTTTGCCACTGAAGTCCTTGCAAAGATACATACC
TCCCTTATAAAGTGCCAAGAGAGTAGATTCAGACCTGAGATTGAGATTTCTCCTATTGGA
TTTTGCATTTCAGGCGCCAAGCCCATCTTTGTGTGCTTGCATCCAACTGTGATGAGCCTA
TGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTGAACACCAAATCAACCTAATTAAGGTAA
GTTACCCATTTAATTTGATTTATCTGAATTGTTAAGAGATACCTTAGTGTAATAAAAATT
GAACCACTTAGAGTTGTCTGGATTAATGCTACTTTATCCTATCAGTAAATTTCGTAAAGA
GCGTGTCCCTGCTTTCTGGTGTGGAACATCACATAAACATGGTATGTTGGACTGTGCTGA
AGCTAGTTACGGAAATGTTATATTCCTGTGGAATTGCTAATTTTGGGTGTTGGTACAGAG
TGAGCATATTCTAGGTGATATTGGTGCTGTACATGATGACAACTGGCTCCCTCTACTGAA
CTGCAGTGAGGAAACTGCCATGTCACCCTATCTGATTACAGCTACCTTTTGGGTCTGATT
TATTGTCAGTATTCCTGTCTGGTAACTAATCCAGTGATTTTTTTTTTAATTCCACTCAAT
AGGTTGATGACAATAAGAAACTAGGGGAATGGGTAGGCCTCTGTAAAATTGACAGAGAGG
GAAAACCCCGTAAAGTGGTTGGTTGCAGTTGTGTGGTGGTTAAGGTAAGTCAGTATTTCT
CTCTGGGATGAATGTTGTGCTAGGAAGCTGTGTGTGTAGGGTTTTAATTGTTAAAAGTCA
GGAAAGTCATAAATTTGTTATTTTCAATATTTAAAATCCCTTTTCTACCTTTCAGAAAAG
GAAAATAGGCTGCAATTAAGCCAGCCAATGAATCTGCTTACCTGAATATGTTTCTGCAGA
AATTTAAAAATTGCTGGCAATAGTAATGCCATGTTACGAGCCTTAAAGACACTGAAGTCC
TTAAGGTCCCTGAAAATGGCTATAAGAAATTTTAGTGTTGTGAAACATTTTCCTAAGACA
CAAGCTAACTTTAACTTTGTAAAGCTTCACCATAACTAGTGCTAACAACTTGGTAGAGTT
TCTAAATGTTTAAAAAATGGTTTTTGTTTATTTTTTTAGGACTATGGCAAAGAATCTCAG
GCGAAAGATGTTATCGAGGAATACTTCAAATGCAAGAAATGAACAAATAAAAAACTTGGT
TTTTGTTCCTCACCTGCCTTTGTTTATTTTGGGGGCATAAGGTCTCTGTTAGCAACGAAC
AAAAGATAATCCTTGTAGAATTAGCAAAGTAACTAACTGGAAACCTGCTACTTCTCCTGA
TTTCTAAAGGAAAGCCTACTCCAACCACTAAAGTGTGGGTAACTGAAAACAATGACTTAC
AGATAGCCTTGCAGTGATTGTGACTGCCAAGGTTTCCTAGATGTCATTGATCAAGACTAA
GGCTAGGCAGCCTAGGACCTAGAGGAAATGGGCCGAGGCTGGTCAGTGTGGTTAACCTTG
GCAGTCCTACAATTTGGCAGCAGGTTGAAAAAGTTGAAGTCAAACTGCAGATATGGGCAG
GATTGGATTTAGGGTATGGGACATAGTAGAAGATGGCCAGAAGTGATTAATAACGGACAT
GCCTATTAGAAAAGGTCTGTCCATGGGGTTTGTTAACACTTGGTGTTAGATAAATGTTAA
TTAAGCACAGAGGCAGGATGTGCTTTGATACGCTCAAGTCTCAATCCCAGGGAAAGGTGA
TTACACACGTATTTCAGGCCTGGACCAAGTTACTGTGAGCATGAATTAGCCATGTAGGAT
GAATAGTGTTGTAATCTTTTTTTTTTTTTTTAGTGTAATCTTAAACCCTGCCAAATTGCT
GCCTGGGGCACTTTGAATCTCTACCCTAGTTTCCCAGTATTGCTGTTTAGTTAAGGAGGG
GGCACATGTGTGAACTGGAGCCAGATCTGGTTTTGAATGCTCACTTGTTGAATAAGCCCT
TTTCTAAAGCCTGCCTTTGGAGAAGTAGCAGCCTCTACCATCCCTGAAAACTGCTGTTCT
CTGCCTGGTAGATTTACTGTGGTGGAATGAATGGCCTCAAAAGCTGTATAGAGTTAAAGC
CATAAATAATGTACCCAGGGGTTCATCTACCATTAAATGTCAACCTGAGATATCGAATTT
CTAAGCAAAGAGCTTTCTGTTGCTCTTGAGTTCTGGTTTATGTCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1022, 1135..1185, 1307..1423, 2473..2575, 3002..3103, 3519..3607
1172..1185, 1307..1423, 2473..2575, 3002..3103, 3519..3578
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved