Canis_familiaris Locus ENSCAFG00000006936
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000006936
Canis_familiaris
ENSCAFG00000006936
21
SNORA3, SNORA3
2143..2272, 3542..3672
4945
GTACATTCAACCACTTGATTTGTTGAACATGTACTACATGCCAGGAACTGGGAGTACAG
GGATAAAATACTCCTGAACCATTAAGGAATTTGGTCGAGTAGGGGAGACAAATGTGGATC
AACAATTATGCACGAGCTATGTATGTACTAGAATATGGGGGGGGGGGGGCACAAGTGGGG
GAAGCAGCAATGACCGTATGGGTCAGAGAAGTTCCACAGGGAAAGGAGACACTTGCATTG
CAAAGATCGAGGTTGAGCAGGGGTTTTCTGGTCCAGGAGAGGGGTTCACAGCCTTGTCAA
GTAGGTTCAGGTGAGAAAATTTGGTGGTTACAAAAAGTATTTAGAGTCTGGATTAAAAAA
AAAACAAAAAACAAAACAAAACCATAAAGCAACCAGGTATACAGGTCCCTGAAGTATACT
GGATTGTTCAAACTCTGGACGCCCAGGATGACAGCACAAGCGCAAAGGAGCAATTAAGAC
CGAGCGCCTCCTCGGAGCGTGGGCGATCAGGCGGGTGTGGACACGTAGGGAAGGGTTCAA
AGGGGGCAGAGCCAGACAGCCGGTGCTCGCTGCGGGTCGAACAGCGCCTCGCGAATCCTC
ACTGCGGCGGCTACCGCCGGGGCCGAGCCGACCGCGAGGACGAGCGAGGCGCGCGCGTCG
GCTCAGCAGCGGGGCGTTCGGCCAGGAGCCCGGGCGGGTTCCGGGGACACGGGGATTCCG
CGACAGGTCTCAGCCTTCGAGCCTGAGCGAACGAGGGCGACGCGGAGGCAGTTTTAGGGC
GGCCGCCGTCACCCGCCCTCGGCGCGGAAGGAGAGGACACCGAGCTGAAAAAGGAGGGCT
ACCGGCCTGGCGGTCACGCGACCCCGCGAACCCCGCGAACCCCGCGAGACTCCGGAGACC
CCGCCCTAGGCCCGGCCTACTCCGGCCGGAAGTGAGTCTCTTGGCTCCGCCCCCGTTGTC
GGTAGCTCGCGAGATTTCGCAGACGCCTCCCTTTTTCCTCTGGGCCGCCAACATGGTAGG
TGGTTCTTTTCCTTTCTCCGCCGCGTTGGTAGTTCAGGCCGCGAGCTGTACTCGCTTTGC
ACCTCAACCACCAACTCCCGGCCTCGGCCCGACCTTCCAGGCCGCTCGGGGCAGGGTGGC
CCGTGTGGGCCCCCGAGTGTGGGCCCGCGTGTTCTGCCGAGGGTTCGGCTCTCTGAGGCA
CGCGGGCCTGCGCGCTCAGGCGCCGCCCTGATGAGGCCACGGGGCCCCGGGCCGACCGGT
CCGTAACATCACCCTTGCTGATGTGGCCCAAAGCAGAGCCTTGACCCCGCAGACCTACAG
ACCCTTCTCAGACGGTCAAGTTCGCCCTCTGCCCCACCCCCCTTTGGCTTTATCACCAAG
CACCTTTTTCCATACAGCCATCCAGACTGAGGAAGACCCGGAAACTTCGGGGCCACGTGA
GCCATGGCCACGGCCGCATCGGTAAGTGCCGGCATCCCATCCTGGCCGGCTCTGAGCTCT
CCCTGCCGGGTGCTTAGCTAGCCGGGAAGTGGGTAGGGTAGAAGTGGGTAAGCTTTGTGC
GGTCATTCGGAGTAAGCTTGGCTGTTAGCTGTTGGTTTTTTCCTTAGAATTCTCTACGGT
ACCCCATTTAAAGACAATTTCACATCAGGGGGGCGGGTAGTTAAAATTGGGACAAAGTGT
TCATTTGTCGAAGGCATGAACACTATCCAACAGTGGATAGTGCTGTGATGTGGAACATTG
CAAAGAGAAGTTTGACCCAGAGTCTTGAGGGAATAGCAATGCTTAAAGAGGTTTTGTAGA
CTGAAAAAATAAAACGCAGAAGTGTGGGGAAATGCTTTTTGCAAGAAGACTTGAACTGGA
GAAGGCTACGTTAGCCATGTAGCTTTGTATTGCAGGCAAACACCGGAAGCACCCAGGAGG
CCGGGGTAATGCTGGTGGCATGCATCATCACAGGATCAACTTCGACAAATAGTGAGTGTT
TCTTGACCTGTACTTTCACCAGCACTGACAGTTTATTGGAGTGATGGGTAAAGGGCTGGC
TCAGGACACCTTCAGTGGGAAGCAAGCCTCTTAACCACTCAAAAACCTTTGTATATTGCT
GGGTTTTAGCAAGTTAACATTTGATGTGAACCGAGAATTTGCCATCGAGGCTAGAGTCAC
GCTTGGGTATCAGCTATTGCCTTAGTGTGCTAGAGTCCTCGAAGAGTAATTGCTGACCTT
ATTCACTGGCTGTGACCCTTATGGCATAGTCAGTCACCAGGTTAGTGACATGCGTCAGGT
GTATAATCTGCTAGATTCACTATGCCCCCAAATTTGTTTAGAAAATCTACTACAAGAATG
TGTGGAATTTCCATAGAGTGGCTGTCAGGTGATACGGAAGATCTCTAGTCTTGGCTCTGC
CTCTGACTTTTTTCAGTGATTTATCCTGGTTCCATGAAGTAAGGGTAGTCTCCTGAACAT
CTTCCATGGCTTTTTTTTTTAAAGACTTGTTTTAATGCAACAATGAATGGAGTCCTGGTT
ATGTCACTATTGTGCACTGATGAACAAGTTACGTTATAACTAGGAGAGATGAACTATGAA
GACAATAAACCTCACTTCTTAATTGGAATCAGGTTATGAAAGTGATTACCTTTCTCTTCC
TAGTCACCCAGGTTACTTCGGAAAAGTCGGTATGAGACATTACCACTTAAAGAGGAACCA
GAGCTTCTGCCCAACTGTCAACCTTGATAAACTGTGGACCTTAGTCAGTGAGCAGACACG
GGTAAATGCTGCCAAAAACAAGACTGGAGCTGCTCCTATTATCGATGTGGTGCGATCGGT
GAGTGAATGAATATTTGTTGACTTTACATGGTCTTTGCCTCTCAAAATTCTGGATAATCT
GATCTACTGATGCCCTTCCTAGAATTTATACCTAGTTACCTACCAGACTACTGTCTTTTG
ACAGAATTTCAACAGGTAAACTCCCCAAAATTGCATTCTAGTTGTGATTCATGCAAAACA
TTCAGCTCTTTCCAGTCCCTCATTCATTCAGTTACTTTTGTTATTTCTTGAATGTTTTTC
CAATCAGTAGTCTCATTCCCACTCTTAACTGTCTTGGTTTGTACAGGTTTGCATTTCTGG
CCTGAGCTTTTGAGCAATATCTCAGCTCATCTGGCTCTGGTCTCTCTTAATACAACCCTG
CTTACATGGGCACTCTTGGCCCTTTATGTCCCTTACAGAATAAAATACTAATATGTTTGT
TAATTGTGGATCTACGTTATTGGAAGAGATTTCCACTCCCCACCCCTGCAAAGCAGTGAC
GACAAAGCATTTTTGTCTATCCTTCGGAGTTCTGGTCCTGTGTCAGTTTTAACCTCCCAC
GGGTGTGGAGGTAGTCTTAAACCCTGAAGGGGCTTTCAGTGAAGTTTTAAATCCCTTTTC
TACTGCCTACTTAACATTCCTTGAGCAATTTTGGTAGGACTTCTTGGAACATTGCTAGGA
ATGTGGTCTTTTGCTTATCAGGTAGTAATTGAATGGGGGGGGGGGTGCGGGGGTTGTGCT
TTCTTGAGGCTAGAGTCACATCCTGACACATTTCTTGTCCTGGTGTGCTAGAGTCCTCAG
AGAGAATCTGCTGGTCTTGATTCACTGGCGAGGGCAGTTGGTGCCCCCGGTAGTGCCCAG
ATCAGAAACATGTCCCCCCAGCTCCTAGATTGAGTAGATTGGCAGTCATTTTTCATCATA
CCAAGGAGTTGGTACCTGCTGTGGTGTGTATTATAAACTCTTTTTCTATTCCTCTAGGGC
TACTACAAAGTTTTGGGAAAGGGAAAGCTCCCAAAACAGCCTGTCATCGTGAAGGCCAAA
TTCTTCAGTAGAAGAGCTGAGGAGAAGATAAAGGGTGTGGGGGGCGCCTGCGTTCTAGTA
GCTTGAAGCCACATAGGGGGAGGTTCATTAAATGCTAACAAGTGCTTTTCTCTTGTGGTC
TGAGTATAAATTCTTTAGCACCCCTACCTCCCTACCTATACATCAGAAATATGCCTAAAC
AGATTTTTAGGAGTAAGGATATGAGGGCCTGAGCTTCTCTACCAGCTCCCCTCAGAAAGT
GTGCCAGAGATGGCACCAGCACATAAAGGATTTGGCCCAGTACCTAACTTGAACATTTTT
GTTTAGAATGTGTGAATGTGATACCTGTGATAGCACATGGATGTATCTTAGAGTTGAAAG
GCTTGTTTGCATTGTAAATTCGGACTATACAATGAGTAGGAGAATACACCCTTAACTGCA
AGTGTGGCTCTACAGCTCTGTACCTTACATGGGGCTTGAACTCAACCAGATGAAGTTAGA
GCTCTACCAACTAAGCCAGTCAGGTGCCGCAAAATGGAAGACTTGGTTATGATCTGATGG
ACAGAAGGATTGAAGCAATTGTGAAAGATGTAATTCCTGAACTGAAGGTTTTTCCTCCTT
GACTCCCATCTTTTTACCATACTATTCTAGTCATAACCAAAAATTTGAGATGGGGCCCAG
CAGTTTGAATGTTAAACACCAGGGCTTTTACACGTGAAAGTGGTTTGGAATCTAAAAGGC
ATTTGTCAGAATTTATGTATCCCTGTGCATAGCAGTCATAATGTTCAAAGAAATAGATCA
TGAAATGCTAAAGATTTTTTTTTTAAAACATTTTATTTATTTATTCATTAGAGATACACA
GAGAGAGAGAGGCAGAGACACAACACAGGCAGAGGGAGAAGCAGGCTCCATGCAAGGAGC
CCGACGTGGGACTCAATCCCAGGTCTCCAGGATCACATCCTGGGCTGCAAGCGGCGCTAA
ACCGCTGAGCCACCTGGGCTGCCCAAAGATTTTAGTCTGAAATGTATCTCGCATAGAATT
TAGACCTAAAAGGCTGGAATCAGGTTTTCTAGGGTTTGTTATCCTACAAAACTGATGATG
ATCAATGCTTGCGTCAGATAAGACCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1397..1460, 1895..1970, 2643..2817, 3777..3945
1012..1014, 1397..1460, 1895..1970, 2643..2817, 3777..3902
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved