Canis_familiaris Locus RPS3
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPS3
Canis_familiaris
RPS3
21
SNORD15, SNORD15
2102..2249, 6201..6345
8541
tgcctgtgtctctgcctcactctctctgtgtctctcatgaataaataaataaatctttg
aaaaaaaaactattcaaatttaaaataaaactgttcatcacagaaaaacttgtttttctt
ttcttcttttctttttattgtatctgtatgacacgatgggtattagctgaacctattttg
gtcatcatttcacaatatttgtaaatcaaagcatcatgctgcatgcctcaaacgtataca
gtgatgtatgccaattatttctcaataaaactgttgttgaggtgtttcagagtaaagtgt
gcagagggctgtaatttaccttgaaaaagatcaaaagatgcacccttgggtggatagagg
gatggatagatatgggataaagcaaatatggcaaaaatgttaattggatcaccttagtga
cgcatatacataattctttcaaccttcctgtgtgcttgaaaatttcaaaatataaggggt
acagttttttttaacggaaaaataattgtgaccccatgaaccactacttggtgacttccg
ttactagttttaatggactttatgaaagtgaggcagaggtaaatgagttcataatataaa
gggcatagaacagtccctagcatatttaataaatattagatatttatatcgccagcattt
ggaacagagaaaacggacacagaagggctggacctaaacgaatttcattgagtgtagagt
gcagggactaggattgcacgctgttgctgtgtgagtttatacctgtaatttccatctctg
cgcctcacgttgctcacttaagctaataagaattggacctaagctcccctgattgatctg
ctccctttcctgtttctgcctatacgtgtctccattacccctcctttttttcccctcttt
aatgccttcctaaaaactacaattcccaggagcgcctacaggcgtcgacgtcgcgcagtt
ctttgtcgtagctcgcgccctttatacctacttccgcccacGAGCCACTTCCTTTTCTTT
CCGGGGCGCGCGGCGGCAAGATGGCGGTGCAAATTTCCAAGAAGAGGAAGgtaagacgct
ggggtctaggttcggggatctgtggtgccgcgcgggtcgaggcttgtcgagatgccgtcg
cgagaccctcagcttcgagccctgcttcgggaagcggcctgggccgcgtggcattcccgc
ggaccgcggatggcggtggattgaatgcgaggcccgagccaggcgagcgcggtttggcgg
cggaagggagtgatgagagacgtctgccgcttctgggcgaagaccagacgtgagcaccgg
gcgcccctcccgcccgagacaaagcgcttgggagcattacttggttaacaggtagcttta
gtaagcgtattttgagaggttgggccgttccccctaatgtctctcactaggactttgggg
ggggaggtggcgtgtgcacgccttcttcgtgtcggggcgcggccccctgacccccgagac
ctcggttggagaggctgctgtatcttgccccgtctctaccgcggagaaagtaaccgggag
ggaggagaaccggacagagcactggatcgagctttaacttttcgcttttccgcaggcgga
aactgtaaagtccgcttgctttagaaagaggcaactaacttgtcattttgtgtgtgtaca
cagcgtcgtgcaaatccacacactttcgaattagagttcagctttgtgagacatgtactg
taggcaagataacatggctgggagtcttctgatggtccctgaaggcagcgtattttcatg
ggttacaaaggtagcatctctgctctgcagacagaaggagttgtgaatgtgccattttat
tttatttatcttaagattttacttatttattcatgggagacacagacccaggcagaggga
gaagcagactccatgcagggagcccgatgtgggactggatctcgggactccaggatcacg
ccctgggccgccctggaccggaggcaggcgcttaactgctgagctacctgggcatcccgt
gaatgtgccattttagagcagctgtttgtttggcatgtgctactcctgaagtctttaaaa
cccttcaatgaagagaagatgacgagtctgactggaggtgttatctttgccaggcggccc
ctactccttgctgcgttctgtggcagttttaagggtccttgggttaaagtaacttccaaa
ggacgatctagaggcatttgtctgagaagggttgttaaattctgtgttggaacaagggta
gtaagagtgatgatgggatgtttgtatgaggtgttgcattggcagaaggacaatgaccct
gccatcccacgttctaattgtgaattttcccttttggttagTTTGTCGCTGATGGCATCT
TCAAAGCTGAACTGAATGAGTTTCTCACTCGGGAGCTCGCTGAAGATGGCTACTCTGGGG
TTGAGGTCCGAGTTACACCAACCAGGACAGAAATCATTATCCTGGCCACCAGgtgagatc
tcattttcctggttagcacctgttacttgttgtatatgctaggttggtgtattctgtaaa
cttccagggagaaccagtgaattggccttattagcaaacgtaagtggtttgtttttgttt
ttaagatttttattcatttgaaaaaaaaaaaaaaaagatttttattcatttgactgagag
tgcaaagcggaggatgggagggggtgttgaggggctgagggaggagcagggagccctttg
ccgggcttgatcccagggccctgggatcttgacctgagtgacctgagccaaaggcagaca
cttaccaactgagccaacgtggcaccccacaaatgtgtattttcgtaactgccttttaaa
tctgattctagctcttgtcatccaaaatttgtattttctatgttagacgggtgagacttc
attaccacatatatgtaaaatttaaagccatgtttgcagttttgtgagagctattgtgta
ttttcgttttctcagGACACAGAATGTTCTTGGTGAAAAGGGCCGGAGGATCCGGGAATT
GACTGCTGTGGTTCAGAAGAGGTTTGGTTTTCCTGAGGGCAGTGTAGAGgtgagtgattt
tgccttttgccagagattaccgtggacctggaaatggttatttagggtggttacttttat
aaacccttaatgtcatgaagaccttagttatcaccaagtattacatatgaattggtgttt
tgttggttgtcttaataagtagcaggctttattttataggccttttctgctcatttctgg
tggttaagggacttttttttactctcaacttaagtatggtaatgatatgtatgatggatt
ggctatcccatcacttgatgtagctgtagaagtatctagggatgagagggcaataaggaa
agattcagactatgtcacagcgtaggctacctatgagtagtaggagtgttttagtacttg
agggatgccacagtgaccacatgcttgtatggtgaatgagttttttttttttctttaatt
gaaaacaatggggaaagttaacaggtttaagggtgtaccttgatttcttcttaaagCTCT
ATGCCGAAAAGGTGGCCACAAGAGGTCTATGTGCTATTGCCCAGGCAGAGTCACTGCGTT
ACAAACTCCTAGGAGGCCTTGCTGTGCGGAGgtaagtgtcctgagacttttttttttcaa
gattttatttatttattcatgagttatacacagagaggcagggagatagagggagaagca
ggctcctcacagggagcctgatgcaggactcaatccctggaccaggatcacaccctgagc
caaaggcagacactcaactactgagccacccaggcatccctgaatgattatgttttaaag
agtggtcagtgctataaagggagtacacttcttggtgcttaggtaatagaacaaaaacaa
ctccagggagaggaggtcagggttcccgttgaagttagctccatgaagtgtggagattat
aaaggcataagacatagtcctgatgggagagagctaatctgagcagtatgtaggtatgat
gtgaggagtggattatagagtgtatgaggtagctagattggccctggagccgggccttct
gatgaggtttcagtaggagctctttgtgtactttcactgttgtaattggaatgcttttcc
tgggtgtatgaaatttaggtggtacttcctgcagagccctgggaggttttctcagcagga
gaagaaattaagagctgtgctttaggaacattgacctggtggggagatggatggcaggaa
aggtgttataggtagggacatacaagaaagactgcctggctggtttgaatgccagctaca
ctacttagaactgtggtcctcaaaagcttaatccttgggctatgatcactgatatccttg
gaggaattgttagaaaaattctcagtctccacctgctgaagtgaaaaggagtgtggatca
gcaaccctttttatacccactgacttggaagttctgagacctgagccacttactgaacat
ttgacccttggatctcctgtttgtaaatggggggtcattatatccacctctccttttagt
ggtgattaaatgagatgatgcgaaggggcttgaacctagagtggtgggtcctgctttact
ttccctgttgaaggtggcagctagctctcctaattagtatgtcctagggtgtatagtaat
aaatgagttggtggggggcatattttacggcttattgtcatttttatagttctagaagta
tcttttccagcactctgttcagggcagctaggagcctacattagtagcttggattcctaa
taaatgtgaattctggagattgaggaatatttagtaaaccataaaggggccgctcagtga
ctgggttcttactgattgtttaccaactcattgtgaaatgctgcatttgcagagatggac
tggatgacctatgcttgagttataccacccccaccatttaattgccagtttaggggtgcc
tgggtggctgagttggttaagcgtccaactcttggttttggctcaggatgtgatctcaga
gttgttagattgaaccatggtcagctctcaatctgtattgagtgtggaggctgcttaaga
tctcccctccctccatttgcatgtgtcctctatcccaaatgaaaaaaaaaaaaaaagagt
aaattcttgagtctgtaattgccagtttaattgacctggtgtgaggcttggacttcacag
gtgttgttctagtttaatcttgaggtgattgtaatgtacacccaatgctgtgaagcattt
gggttagaaggaactggaatatatattccttaaagaattaccttaagattaggtgtgata
ggaatggagaattgccaggctctggtcaaatttattctccattaaaggaacactgaagat
attgtagactagtaagtctatggctttgtttttatttttttaagaatgacagggtggtta
ggatgcctgggtggctcagcagttgagcatctgcctttagctagggtgtgatcctggggt
cccaggatcgagtcccacattgggcttcctgcatggagcctgcttctccctctgcctgtg
tctctgcctctctctctctttttctctctctttctctgtgtctcctgtgaataaataaat
aaaatcttaaaaaaagagaatgggaggtgggatggggatagggtaggcttgaatagtctt
gtctttggttataacaggtggatgtttcttgttctcccaaagGGCCTGCTATGGTGTGCT
GCGGTTCATCATGGAGAGTGGGGCCAAAGGCTGTGAGGTCGTGGTGTCTGGGAAACTCCG
AGGACAGAGGGCTAAATCCATGAAGTTTGTGGATGGCTTGATGATTCACAGTGGAGACCC
TGTTAACTACTACGTTGACACCGCTGTGCGCCATGTGCTGCTCAGACAGGgtgagcagct
gggagtgcttgaggcagagggcttttagcagatagatgtggttttttttcatgtatacct
ccatgtcagggaacatgttttgggagtagtggagcatgtttgtactccatgtgagtttat
tcacgagctgcattgacctctaagaagtaaattgctgagatccaagagttggtttgcttt
tgtctcagccacctatgtacccttcggtgatgacacgatgacgagtcagaaaggtcacat
cctgctcttggtccttgtcagtgccacgttctgtggtgctgtgcatgggttccttttgca
aaagtgtcctgtttattgattgattagaggcatttgtctgagaagggactggatccatgg
gtgcttgagtaacctactattattttactctgctctatcctattgtgggacaggtacaac
cacagctagattctaattatggcatcttccagGTGTGCTGGGCATCAAAGTCAAGATCAT
GCTTCCCTGGGACCCTAGTGGTAAGATTGGCCCTAAGAAGCCCCTGCCAGATCATGTGAG
CATTGTGGAACCCAAGGATGAGATACTGCCCACCACCCCCATCTCGGAACAGAAGGGTGG
GAAGCCAGAGCCGCCTGCTATGCCGCAGCCAGTACCCACAGCATAAATAGgtgtgtctct
aggggcttcttggggtgggcatgaaggacccttatcctttgtctccctaataattgtata
tcccgtactgttgtaagcacttgctatgtaaacattggattatacttaccacggttggag
ccagaggcccatttaaccagggattctgtaggaagagagatttgcctttagtctcctaag
acattcctatgtttaccagtgtgtttgaaacaagaattttccttttatttacttaaaatc
aaggcactcttgttagtagttacctgttgttcagcagccccttcagcagttaaaaaggta
tcaccaatcctcttctatggctagcaccttttgtttgtttctaggtgttctgtgtgtata
tattcttcatgcaaaccctaaatgagaaatgaaacaacccaatattcaggtgaagattct
gttcttactgttgtgctctatttggtttcagGGTCTCCTTGGCAGTTGGATCTGGAGGCT
GGATTTTACTCTGTGAAGACCTTTAATAAAATATTTGAGTAAAACACGTGGCACAAATAG
ACTGTCCACTATTTGGTCTGAGAATTCTATTGCCTGAAGGGAACATTAACTTGGTTGGCT
GCCGGCCTCATTTTCCCTGAAATCCTTGGTTTCAGCTGTTGTTGTGAGGCAAGAGCCAGA
ACAGGAAGACCCAAACAGCTAACCAGAGTAATATCCTATAAATCTGTGTAAAGTGAAGGC
TGATTGCTAGTTGGATAGCACCTTGATTAATTCACCCACAGTTTGAGGTTATAGGTTTGG
AAGAGGGATATATTTAAGATGTTTTTCTTTTCTAATGCATAAAGAAATCTTATTGCACAT
AGAAAATAAATACGGTGCCTATTGTATTTTCGGTCATTTCTAcactataggtagttttgt
ataattctacattttatcctgagcatgtctgaagtgtaaagggaatttgcttgtgccact
gaaaagcctgagaagtacatttattagaatccacacttctttgttcagtccttttagcca
ttatactttagaagaatgtaaagaacatttacattgtctacagtttgtcatatttgaagt
gctttctattgatagttataagaaatggggtcctcgtagtttctttgggtgaaagtagtg
tgggaccaaggtggcatgaaaatcctacgtggctatatagggaatgagttccattgagca
cagcgacaaatgtatctctgccccctccttcaagaacctttgatatttatgctgtatcta
gaccatcacctattgctggttttgtcagtgtggttttgttttaaagattgtatttattca
tgagagacccagagagagagcgcggcagagatccaggcagagggagaagcaggctccatg
cagggagcccgacagggaactcgatccctggtctccaggatcacaccctgggctgaaggc
tggtgctaaactgctgagccatcagggctgccctgtttttgtcagggttcatggaactga
gaccacctatcactagtagagacacttccctttagaagtccataacctctggcaaagcta
acgtgtttactgttttagggagtggaatgtgtatattctagtccctaatgtattaggaac
tagagcctgaataaaaaatgtaaatgttccttatttccccattcttcccctcaccttgag
gtgacagtttctcaagctgatgaaagttttctgggaagggctaaggaggaggtgatttta
gacaggctggtgttgggcctcgtcagtactatatgtgtgtaaagtgagatttgagtgctc
tggataaatgattctgtgcccacccccaaatctaatgaaatacaggcaatagggtttttg
tttgtttgtttgtttgtttttt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 2381..2511, 3015..3108, 3596..3690, 5802..5989, 6452..6649, 7111..7541
1040..1069, 2381..2511, 3015..3108, 3596..3690, 5802..5989, 6452..6645
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved