Canis_familiaris Locus ENSCAFG00000004233
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000004233
Canis_familiaris
ENSCAFG00000004233
21
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
5116..5241, 6474..6604, 7521..7659, 7896..8030, 8752..8877, 9163..9291
10474
TGTTTGAGCATTTATCTCATTAATTCTTAGATCTTTGCATTTTAAAACACTACCAACCA
ATCCTAAGATTACTGTGAGTCCGTCGGACAGTTTGCAAATCTCCAAGATTTGCGTTGACC
TTGATGTTTTTCCGTATTTGAGGTATTTTGCCCTTTTATCCTAGGGTTTCTTTCTTCATC
ACTCACTTGTCCTTCTCAAGCGTACTAAAGACTAAACACAAAAACGGAAGAACGCCGGCA
TCCTCTATAAGGGAGATGCGGTAGTGAAACAAGACTTCTTTGGGGTTTTTTTTGCCCATT
ACTCTTAAGATCTCCCAAGGAGATTTTGAAAAGGGAAACATAGGGCACCATTGTGTGGTC
TGTGAGCATTACACTGAAAAGTTTGAGAATTCAGGACTTAAAAAGTAATATGCCAAGGAA
GAGGTTGCACGGTGACATTGATGAATCGTGCATAGGGTGAATGAGAAGAGGCTACAAATG
GATATCCAGGATTTTTGATTGAGGTGGTAAATCGTAATTATTTTTCCTGGTATGCTGAGG
CAACACTGCCTTCTGGCTTTGAGTTATTCCAAGGAGTTTACGTCTGCTGCTGCCTTTGGC
CATTAATTGTACGTGAATACTTGTACATACATGGTTAGTAAAATTACATTTTGTTTTATG
AGAAGATGTTTAATACTCTTTATGGAAATGACAGTATCGTTCTGGAATCTTAATCCACTG
GATAGATTTAGAAGACAACTGAAATAGGGAAGCAATTCAATTTCCAGATTTTAGAATTTG
ATTGCAAAATGATAATTCTTATGTAAAAATGTTATGGGCTTTGTATATAATTTTGCCTTA
ATTTACATAAAATGGCATAATACAACTACATTAAATTTTGTATTACTGGGATGCTAGCTG
ATTCTGTTGGCATTTGTTCAGAGACTACATTTACTGAATTTTCAGAACTCTGAAGCAAAC
AAGTGGTGAATACAATTTGGAGAGGACTTGGGAGAATAAGTAACGAATTTTCTCAACCTA
TAATGGCATCTAATTCAGCTGTAGAAATTGACAATGAAAGGTAAGTGCCTTTTTTTTTTT
AATTCACCACCACCACTAGATTTTTTTACTGCAAAACTGACTAAATTTGACGATAACCTT
TGTATTACTGGGTAAGCAGTAAAGATGTTTTTCAAGAATTAGGAAAGAAAAGGAAGGTCT
TCAATTTTACACAGGTCTTCAGTTTATTTATATAGTTAACAGTAGGACACGTTCTTAACC
CAGGGAAACAGAAGAATATTCTCTGGGCTAATTTGATCTCTTTCTGACTAAATCACTCCT
AATCTTAAAACAGGAAAATGGACATCAGTGGGGAATATTGCTTAAAAATCAACTGGTGAT
AATGCACATTATAATAGTGGTCGCAGGTAATATATACATGATGGAAATACCTAGTTACTG
GGAAATCAAATCAGCGTTCCTCCTGTTTTCAAGTCAGAATCTATCTGCTAGGCTACTCTT
GCATTATATCAAGCAAGCTCTAGCAGTAAACAAGACTGTCTTTGGAAATTAAAGTTAACA
TTATTTCTCTTGGAAGATCATTTTTTGGTAAGTGCTATGGCATATGGCACATGGTGTTAC
TATTTTAAGTAGCCAGAACTAAGGAGTTGGCTTAGTTAGTACTGAGCCCATATTTTTAAA
AATTATTCTGAACATGTTTTCCTGCTTTTGGTCTGTGGGAGAAAACTACATTATGGTAAT
AAGCATTTGGTAATATAAAAGGGTGCAATTAATTTTCCCCCTTTTTTTTCCTAGTGATAA
TTCTTCTGGTAGCAGCTTATTTAAGACTCAGTGTGTCCCTTACTCACCAAAACAGGGGCA
AAGAAACCCTATTAGAAAGTTTGTTCGTTCATCTGGAGGTGTTGAAGCAAGGGATTCATC
TAGTGACTCCTCTTTTGAACCAAGACCACTGACTTTAAAAGCTATTTTTGAAAGATTCAA
AAAAAAGAAACGTAAAAAGAGGAAATATAAGCCAAAAGAAAGACCAAGGGGAAGACCAGA
AGGAAGAAAAACCACTAGACGCTCCCAAATAAATAAGAAACAAGTTAAAGACAAAGGATC
TGGGTTCCCATTTTTAGAATCTGAGAATGTAAAAAAGCCATTACCATGGAGAAAGATTTT
AAGCTTTGAGGTGAGTCAGTATTTTATATGTAGATACACATAGCTAAAAGTCTAATCTGA
CTTGTTGGCCACTTTAAGAGTTTAGGTATGCCAAAAATTGAATCTGTGACTTTGATAATA
TTCTTCTGTAGTGACTTAACTGCCACTTCAAGACCAACCCATCCTTTAGCACAGACTTCA
CCTGGGTTTCTGGGTGGATTGTTAGCTGGTATATTCAGTGAATATACCCATATATGAGGT
GCCTCAAGGCTGTTTATATAAAATCCCTTGGTCTCATCAGGTCATTATAAACATCCCTCA
AACTCAAGTGATTCCAGGTGTTCTATAGTAACCTAAGTCAAACCCACCCATATCTTCCAT
GTGCAGTGGCTTTAGTAGAGGTCATCTTATACTGAATATTCGATTTTTGACAGAATTGCC
TCATAACTTAGCAGTAAATTCAAGTATTTGAGTTAAATGCTTGCATAGTTTATAACATTT
GCTCTAGAATTGGTGATTTCAAAGAATACTCTCTAGCCTTTTATGTTTTAAGCTGATTAT
ATGAACATTAAAGATTTGTTTGCATTGAAAATGTTTTTAGAAATTCCCAAACCAGATTTG
TGCTTAGTTTTTCTTGGTATACCAATTTAGATAAATTTGGTAATGTGCTGGGTAGATAGT
GGATTCCTTTTACAACCAGCATCTGGTATATGTGACCCACATATGGAAGAGCGAGTAAAT
TAAGATCACTTACAGAGTTTGGTGATCTTGAGACATGAGAGAAAATTTTATATTTTGTAA
GACTATTAAAACTGTTTGATATTCAGCAAGCGGTGGCAAGAGGATTTTTCAACTACCTTG
AAAAATTGAAGTATGAATACTATCTCAAGGAATCCTTGAAACAAATGAATGTTGGTGAAG
ATTTAGAAAGGGAAGATTTTGACAGTCGTAGATACAAATACTTGGATGATGATGGATCTC
TCTCTCCTATTGAAGAGTCAGAGTAAGTTTAATCATGTGACATATTTTGTTGGTCTAGAT
TTTATTGAATTAAATCTGTTTTTAAATTTGAATGTTGGCGCACCTGGGTGACTCAGTGGT
TGAGCATCTGCCTTTGGCTCAGATTCTGATCCTGGGGTCTGGGGATTGAGCCCCACATTT
GGTTCCTGTGGGGAGCCTGCTTTTCCCTCGGCCTATGTCTGTGCCTGTCTCTCTGTGTCA
TGAATACATAAAATCTTTAAAAAGAAAAATAAATTTGAATGCTAATTGTTCCATACTGTT
AGGGATTTGTCTGTACTTGAATCGTGATGTGAGCACATACAGTAAGCCATGTGGGCTGTA
GTTGAGCTTGGTGCTTGAGCCATCTATTTTGGGATGTTATATACATGACAACATAATTAT
TCTCCTTACTAGTATTGCTGCTTCAATTGTATATTAGGACTGTATACTACTAATTGGGTT
GTAGAATATTTTGTCAGATGAGTGAAGATATATTTTAATGTTACAGAACAGTGGAAGAGG
CTGCAACAACTCTTGAACATGATGATGGATGTGATATCAAATTGGTGGTAAGTGACATTT
TTGTCCCATTTCATTTTTGGAGGATAGCAGTTCTGTGGGAATAATCTAATCCATTATTGT
CTGAATTTAGTTCTTGAAAGGTGCCATGGATTTGTTGCAGGGAATGTAAAAATAAAAATA
GGGGTTATTTGGATACTTGATGAGAACACAGGCTTTTCAGTAGTGTTAATAAGTTAATAG
GTTAAGTTTTGCTGTTAGGATGTCTAATTAGGATTTTCTAATGAAAAAATAAGCTGAATT
TAATTAGGTTTTTAACATCAGGTCTTAGTCACCAAGTGATTTAAGTCACCTAGAGTTGTT
AATGTGTAACTACTAAAGCAGTAAAATTTAGTAATTAATACTGATCTTTTTTATGCAGGA
CAATAATGAATTCATAGTAAGTTCTGAAATACCAAAGAAAATGAATCTGTATTTAGGACA
AGAGGAATATACTGAAGAAGCTGCTTCGTCTAAAAAGAGAGCATCAAAATCCAAAAACAT
GGGACAGAGGATAGAATGGTCTGAAAAGGAAGAGATAGGAATATGAATATTAAGGTAAAT
GGGAAACAACTTTTCATAGAAAGTAAAGGTGATAGATGCAAATTACCTATGTTGGTGTAG
TGATAGAACCTGGTTAAGGAGAAAAAAATCTCTGAACAAGTTTATGAAACTCCTACAAAA
GAATTATTAGAAAAAATATTTTAAAACAGTGAAATTATACATGTAGAAAAAATTGAGACT
TGCCTAGCACCAAATAATAAGTAGAAGATCTTACTGTTTTGTCTATATTTATTTATTTCA
GAGTTTGCAAAAATCCAGACTTTAAGATATGGAAGTTTTTTCCTTTGTGGTTCTATAGTA
GCTACTTGCTACTTTAATACTTGGTCTTTATCTCCATACAGACTCATTCTTTGTAAGCAT
TTTAAAAATTCTTATAATTTACAGTGACTTCTTTCAATCTGTTGTAAATGGAAGGATATT
TGAGCATTCAAATTAAAGAAATTAGAGACTGTAATCCTGGAAACCTTTATTATGGTAATC
ACTAATGATGGACAAACAACCACAACAATCGATTCCTCCAAGTACTTAAAGCCTTTTATG
TTTTGTTTGTTTGTTTTAACATTTTACTTATTAGAGTAAGAGCATGAACGTGGGGAGAAG
CAGATTCCTTACCGAGCAGGGAATCTGACACAGGGTCCAATCCCAGGACTCCCAGGATCA
TGACCTGAGCCAGGCAGGCACGACTGAGACCATTTTGATCACGGTTATTCAGACAACAGA
GACCTTTAGAGTCGAATGTATAGTACTGTAATAAGCACTTATAAGAACTAGTTAGACTAT
CTCAACTACTACTTTCTTATCACTACTGTATATTGCTAATTAAATTATGCCACTAAATGT
CTAGGTATTTTAGGATCGCACTTGTACATGTTTTTGTTTAGCTGTGAACAAAGACTTAGA
CTAAGTGCAAAAAATAAATCCTCTTTTGCAACCCAGAACTCATGGCTCAGTATGAGTTTT
GATACAGATAAGAAGGAACAACATCCCTAAAACAGATTAAAGTGATGGTAGGGGTATTGA
CAAACTGAAGGTAGTTCCTAGGCTGTAGAACTACTAATGGCACAGATAAAAGGTTAATGT
CAGCTATGTTGAATTGGTATTCTAATTTTAACATTGACATGAAACAAAGATGCCTTCTTT
TTTTAGGCTTTTCACTTGAAAACAGTGTCTGGACTTAAAGGTATGTCTTATGCTTTAGGT
GAGCTTTTGTATCGCATTTGTTTAAATGTACTTTGTCAGACAACCTAAAACCTCCACAGT
TTTTTTTTTTTTTTTTTTTTTAATATTTTATTTATTCATGAGAGACATAGGCATAGGGAG
AAGCAGGCTCCATGCAGGGAGCCTGATGTGGGATTCGATCCCCGGACTCCAGGATCACGC
TCTGGGCTGAAAGCAGGTGCTAAACCGCTGAGCTACCCAGGGATCCCCCTTCCACAGGTT
TCATTCCTGAAAGACATTTTTCCAGTTTTAAATTTCTGTTTATAACATGATTCCAGAAAA
ATGAATTTTAGGGTTCACACATTTTCTAGTGATAAGTGCAAGCTTCAGTTTACTTGCAGG
AAAAGGTGTCTATGAATTAAGTTTATAGAAATCAGAATACTGGATACCTGTTTTATGCAT
TTATTTTATTTTAAAACTAATGCATCAAAAAAATAAAACTAATGCATCATCTAAAATGAA
GTGTAGGATTTAATAGTGTGATGTTAGAAATGATAGAGGACACAAGATTTCCTAAATCTG
AATGATGCAAAGGTTAATTAGAAAGCACTCAATTTATCTTCCAATAACTTCCTAAATGGG
AAAAACATAAATACAGCCACATTAATATTTTCCTGTATTTTTAATAAGTGATATCAAATA
ACTATAGCTCTCAGATGAGGCAGAAAATTAAATTGGTATAATCTGGAATGTTCTAGATAA
AACATGATGTTAGTAGAGTTTGCAAAATCAAGACTTTAAGATGTGGAAATCTTTTTCCTT
TGTTGGTTCTCTATAGTAACTACTTGGTACTTCACCTTTAGTACTTGGTGTTCCATCTCC
GTACAGACTCAGACTCCTTTCTGTAAACATTTAAAAAAATCCTTATGTAATTAGTTTATG
GAATGATTTCTTTAAATTTGTCATCAGTGGATGGTGCTTGGCTTCTTGCACAATTTCGAA
CTCAGAGCAGATCACAGTTATTTTTGTTGTAGAATCTTTAAAAAATGTAAAGGGTTTGAG
GTCTATCCCGATGGGGCTTTTTCTGTAGACCTACATCGTTGGAAACGCCTCATAGAGTAT
ATGTGTGGTTTCCTTTATTCACAGAACTATATGTTAGATCTGTGGGAAAGAACTACAAGA
CATCTATCTGCTAAAACTCTGTGAAAGACCTAATCGCATCTTTTAAATCTTAGGTATTGG
CGTATCCCAACAATCTGTACAGTTCTAGGGTGTGATAGTTTAGGTAAGTTTTCATTGGGG
ACAGTGTAATCTTTGGGGTACCATTACAGTTCACATGATGAATTTAACTGTTCAACTGCT
GAATGATACAGACATGAACTAAAACTTAATTCTGACAGAGCTGATCATAGCTAAAAAAAT
AATTTGGATACTAACATATTTTTAGATTTTAATCAAACTTAAATTGTCTTTAATCTTTTA
TTTGGTATTTTATCTTTAGGGGTGAATACGATTTGAACTCATTCATGTTTAGAGGTAGGT
GGAATGTATAATTTCTGTTGAAATTTTTTTTTCTGTTGAAGTTTATTAAGGATCCAAAAG
TTCTGAAAAAGTAACAAGTGAGTAGCATAGTCTAGTGTTATGCAGGAGTTAATTTGATAT
GCAACAGAAGTATCTAGATCTTATACAGAATTGGACAAACTGAAAAGACTGCTTATGTAT
AGAGAATAACATGAAAATGCCCCTCTCTTTGAATCTTTATTAAGCAAGTTTTGTGGTTCA
TCCTAATAATGAATATCTGGATACGTTGCAAATAGGGATATATTGGATTTTCTTATTTTG
CCTAATAGCAATCTGAGCAACTGTGATCCTGATTTCTAATGCATGATTTCTTCTAGTGAT
TTGACTTAATAGTTCTGTATGTACATTATATAAAGATAGGAAAGATAACAGGAACTAGGT
TTACAAATTAAGATGCACATAAGATGGAATGATAATTAGGAATAAAGGTCAAAATACTTT
ATAAGAACTAAAGTTTCTTGAAGTTTCTCAGGTAGTAGCATTGCAGTCTTGAGGTAGAGG
GGTTTACAGTTTAGTCAGGATTGCACTGCATGGTATCTGCACTTAGCAGCTCAGGTCCTG
CTGGGTGTTCAAAAGACAGTGCAATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGG
CTTCGTGCATGTTAAACCTGGTATTTTTATTGAAACAGTATTCCTATAGTTTTTCATTAT
GTTCAGTTTTGAGGTACTCTTCAAGAGGAACTAATGCTTCTCTTTTTCTAGGATGTTTGA
GAACCAGGAAGATCATTTATCTATTTAGACCCTAAATGGGTAAGGCTTTCTATCTCTTGC
TTCTAGTGGCTGCTTTCTTTTGGTTGGGAAAACAGCAGGACTTCTATAAAGATGTAGAAG
CCTTTGTATAGATTATAAACTTGAGAATTTTTATAAAGCCTCATTCTAGATGGTAATGGG
CACTGTCCTTCATGGTGTCCAGAAATTGTTAATGTGGCTACATTGAGACACAGGTTATGC
TTCCATCACAGTAAGTTTATTGCTGTGGTGACAATGAGGCCTGTAACATTTTGTTAGGCT
CATGGGGTAGAGTAGAAGTGAGACCTTTCAGTATTTTAGGTCATTTGCCAAAATAGCAAT
CTGTACGTCTGCAATTTTCTAGGGCTCTAAAGAAATTGGACCTCAAAGATTACAGGTGAG
ATTTCCCTTCAAAAGCCCTTTGTTATAGGAGATGGAATCCATTTACTTACTTAATTTTGC
AGCAGCTAATTCTAGTGGTTCATTATCTCACCACTTTAAAAAAAAAACAAAACAAAACCT
AGATGTTATTAAAAGGACACAGTGAGTGTTTATATGGTTACCAGTGATTTGTGATGTTAT
GATGACAGGCAAAATGTTCAACTGCTCTGAATGGGCTGAATGAAAGTAGCCTTTCTGAAC
ATCCATCTAAATGTAAAAGTTAACCATGAATAGCTACTTTTGGTGTTAATTATTACAGGG
CGTTTTGTGTCAGGGTATGAATGCAGATGTAGATAGTCTTAATTTGTTCCCACATTTAAA
TGAACTGAATTAAACAATTATTCCAACTGTAATTTTTAGTGTGGAATTTTCAGCACATAA
GTAATACAGAACTGAGTTTTGGGATACTTTGGAATCTGTATGTAATTAACTGCATTTTGA
AAAATTTAAACTTTAAAATTTTCCATAGTGGGGAGTTTTTGAAGTATGTCCATATTCAAG
TGGAGATCCGAGAAGACCTCTGGCAAGTTTATTCTGTATTTTAACCATATAATGGTCATT
ACCAAGGCTTTGAGAATGCAGTTTCTCATTTGCTGTGGACATGACCATAAAAAAATTTTC
CCGTTAGGTTTTCTTCCTTTTTGCTAGTTTGCTAGCATTCAGCCTATTGGGAACATTTTT
ACCAACCTCATTCTGTTTCCACTGCCTAGATCAGCATTGTCCAGTACAAATTAACACAGG
CCATAATGTGATTTGGTAGTAGCTATATTTCAAATTCTCATCTGATTACATGGCTAGTTT
ATTGAACAGTGCATGCCTAGATCTCTACTCTTGCAGATGTCTTTTGCTTAATCCTTCTGT
TAACAATCATGCATGTTCCTGTTACATAGGACAGTGACAGCTGTGGATTGAACAAAAGTT
TGTTTTAAAAGGTATGTGCACATTTGAAAAAATACCTTGCAGTAGGTCATTTCAAAGAGG
GCTTGTGGGACTAAAACCAAGAGCTCTTAACGCTGTGACCAAATATTGGAGTTCTCCATA
GGATGTAATAGTTACTCAATAGTGCTATGTTTTTTCCTGAGGAGATACAGGATTTAGCTG
CTTCTATGACTAGTCAAGTGGGATTAAGAAATGACTCCCAAATTTAACCAGTGTCTGCTT
TCGTCCTCAGTGCTATTTTGAAGATCATCACTCTGGCTTTGGTGGAACTATGGTGATTGG
CGGCAGAAGGAATCACATGTCAAATATCTTAAATAAAAATTTTATTAACTTTGTCAAATA
TCTTAAAAATTTATTAATTTTAAATAATTTTGCCTATACCATACATAATTTAAAAAAAAA
CTTTACACCTTTAGTAGAACTTTACACCTTTAGTAGAAAGTCAGCACGTATTTTTGGCTC
GAAGTCTCTCTAGTGTTTTCTGTAGAGGAACAAAAATTAAATGCAGTTAACAGCTGCAGT
ATACCCTAGACGTGGAAAAATACCTGTAGAGGACCTAGCTCACCTTATGAAATTCTTTTG
CCCTTGCTCTGTTTTGGGCATATACATCTTGCTTTGCTTTCTCTTCCCTTTTCTGTTTGA
CTTCAGCTAACTGACTGTAAAAAGTTCACAAATTTAGGACACACACCTTAGGAATGTGAA
TTACTATTCATACACACATACATACACCTCTACCTTAGGGCTCTTTGATGCATGAGGGCT
TGTGCAGTCTTTCTGTCTTCAGGAAGTGACACTCTAACCTTAATCTTATTCACACCCTTC
AGGCGACTCACAGCTGAGCCTGAGCAGAGAACAAGGGACTTGGCAAACATTGCAATGCTA
CATTCTCTTGTGAGAACTGATGGAGGTGGTGTGGAACATACCTATAGGTTTCTCCTTAAC
TGTTTTGATTTGAGAATTTTCAGAAACACGAAATTTATTCTTTATTTCTTTCTGTCTCTG
GGAGGATCTCTCCATAAATGGCTTTTTCCTCTTTAAAAATGCTTCTTGTAAGCTCCCAGG
AAGAGCTGTGATGTTTGGAGGGGTTTCTGTTTTAAAAAAAAGATTGTGGGCAATGTGGAC
ACTGGAACTGAATAGGGAACTCCCGCTGGCCCCTCTGTTAACACTAAGCATCTCAGACCC
CCTAAGGCATACCTGCGCACAGGATTACTGGCTCCTCCAAGTGGTGTTCTGATAAGTCTG
GGTAATCTGAGGTTGCTGTACTCACCTAATTGCAAAAAAATTGTAGATAAATTTAGCACT
GTTCACCTCATTGAACAGAATCACAAGCATAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1794..2169, 2966..3141, 3646..3706, 4078..4253, 5406..5439, 8122..8154, 8668..8721, 9089..9130, 9370..9474
1001..1059, 1794..2169, 2966..3141, 3646..3706, 4078..4242
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved