Canis_familiaris Locus NAP1L4
snOPY snoRNA Orthological Gene Database
Canis_familiaris NAP1L4
Canis_familiaris
NAP1L4
18
SNORA54
10108..10230
25803
TCACTGGAAGAGCTTTGGCAGGGGGTGGGGTGGAGGGGGTCTCTGATGTGTGTTCTCTA
CGTCTGAGATGAAGGAGCTTCACCACCTCTGTTCAGCTATGCACTTAGACACGGTTTTGA
AATTTCCCTAATATCCAGTTCTTTGTAAGGAGTAAGTGTCCTAGAACCTAGCTTTAATGT
TTATAAGTAGAAAACCACCTAACTTGAAGATAATCCTTTGTTATATATGTCTCGTAAAAG
TGGGTTGTACTGGTGTATGTCACACCTTGTTTTTACACAAACACTACCATCTTCAGTGTA
GGAGTGATAGATTAAATTAAATAAAGTAAAATTTTAAGTAGCCTCCTGGGGGCCCTGGGG
GGCTCAGTTGGTTAAGCATCCAACTCTTGGTCTCAGACCCAACTCTTTGGGTCTTGATCT
CAGGGTTGTGAGTTCAAGCCTCATGTTGGGCTGTGTGCTAGGTATGGAGCCTAGTTTAAA
AAAATAAAAATTCTCCTGTGACTTAGAATGTGAAAGACCATATAAGCACTAGTAAATACT
TTGAATAGTTCCAAAATAATTGACCTAGTAGCATAAATATGTCCATATTGCTGAAGCTTA
TTAGAGAAGGTAAATTAAAAATTAGAACTGATTAATCTTACTCTGAGCTCTATTTTAGCA
CCAAAAAGATTTTTTTTAATGAGTAAAGTGTTCATGCACTGAAATGCACAGATCCTAAGT
GTAAGATTTGATGAATTTGGTAAGTAGCATATGTAAATATATATGTAATATATATATATA
TATATATATATATATATAAAACTGAGAAACCCAATAGTCTGTCCAAGATTTAGAACATTT
CCATTACTCTAGAAAGTTCCTTCCTGCTCCTCCTGGTGTAGACCCTCATCCCCCATAGTA
GATAGCCGCTGCTACACACACCCTGAAAAGTTCTTTGGGAATATTTAGTGATGTTAATCA
TTACAACTCTCTCTTAATTCTTAGGAGATCAAAACATTCAGATGGCAGATAACAGGTAAG
CCAAAATGGATTTTGTTTATTGGGGTTTAAGTTTGATGAGCATGAGCCAAGTCAGTGAAT
ATCATTAGAAGCTCTGGTTGAATGGCTCCCCCCACCCCTCCCACCCCCCCCCTCCCCCCC
CCGGGTGTGTTTGAGCCCATGAAGAAACTGCTTCACAACATGGGAAGTGTCTCAAATATT
GATACTGGAAAACCTTTTATGGGAAGCAGTCATGTTGCTCTGCAGGCCTTAAACCTCCCA
GGTGAAGTCATTTGATTAACTTGACACCATCCTTACATTGTATAGCCTCTAGTGGTCAAA
TGAAAAATAGATTTTGTTTGTGGCTTGTTCTGAAGGTTATGTTAGTCTTGTGTAGTGTTT
GACATGGTTTAATTTTGGTGAGAAATTCTATCCAGACATCTTTGAAAACCGATACAGCTG
TTTTTGTGGAGTTTAATTGTTTGTAGAGACTTTGGTGAGCTTACAGAGCCACAGTGGGCA
TTGTGTCCTAAAAACTTGGTAAGGTGGCTCTTCTTTGATCCCTTTAGCAGCTGACCAAAC
TATAGCATGCATGTTAGTTGGCTAGTGGGTTTGGTCTGAGGGTGGGGAGCAGATTTTGGG
GGAAAGAAACTATAGAAATGAAAACTAAGAAGCTTTGGTCAGGGTTGGAAATGAGAACTA
TGGGGTGTGGCGGGGGGTGGGGCATGAGGGGTTGTTAAATAGTTTTTTTTTTTTATGTAG
ATACACCTGTGCATCTATAGCTCTGTCCAAATATGAAGGCGTTGTAGAGGTTTTTTAATA
TGTTAATGTCCTTGTGCTGTTTGTTTTTGGAACTTCTTGATAGTAATAATTTATAAAATG
TACTTTAGTTTTTCAGATGGTGTTCCTTCAGATGCCTTGGAGGCTGCTAAAAATGCAAGT
AACACAGGTCAGTTCACTGCCCGTGGGGAAAGTAACAGTTGAGTTTGTGTGCAGAGCAGA
GTGTGTTCCATTCTTGAAACATTTATTGCAATAATATAGGTGAAGGGTTACTGTGCTTCA
AAGGTTTAGGGAAGTTAGAGTTGGTCAAGTGGGAAATGGTACTTCGTTTAAAAACTCCTA
TGTTAGGAGCTTCAGGCTTTCCAGAAGTAGGGTGACTAGCATGTCCCCTGGTCCCTGCTG
CCACCCGTTACTGGAGCTTGTCAGCCAGTGACCAGTCTTTTACATCTGTGTTCTTTCTTC
TTCCCTAAACATTTAGAAGCAAATGCCAGGCTTCATATCATTTTGTCCATGAATTCATAG
ATGTATTCTTTTATCCTCCATTTTAAAATGTATATATCCATACTTTTTTTTTCCCCCTTA
AACTGTTTGAAAGCAAGTTGTGGGTATCCTGACCCTTTTCTCCTAAAACAGTTTTGTGTA
AATTTCCTAAAAACTAGGATGAATGCTCCCAAACACAATGCTGTGACCACAACCAAGAAA
TGCGGGGGTTGGGCAGCCCTGGTGGCTCAGCAGTTTAGTGCTGCCTTTGGCCTGGGGCCT
GATCCCGGAGATCGGGGATCGAGTCTTGGGATCGAGTCTCACGTCAGGCTCTCTGCATGG
AGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCCTCTCTGTGTATTCTC
ATGAATAAATAAAACCTTAAAAAAAAAAAAAAGGAAAGAAAGGCGGGGGTTGACAGGACG
CTGTTAGCCAATATGTAGTTCTGTTGCTTTTCCCCTGCTTTTCTCGGTTGTTCCTTTTTA
ACCATTGCCCACACTCAGGCCCAGGGCCAGCCAAAGGTCACGTCCCGAATTTAGTTCTGT
CTCCTTTATTCTAGAACTCCCACCTTTTTATCCTACCCTGCAGTGACACATCCACAGGTT
GTGTGCCCCGCTGTCTTATGGATTGCCCAGGCTTTGGATTCATTAGGTTGTTTCCTCCTC
ATTAGGTTCAGACTGCCACATGGGTGACCTGATGCAGGGGAAGCGCAAGGGCCGGGGATA
CTGAGATAGAGGACTTGGTGGAGGCACGTGTCTGGCACCCTTCCCCGTAGTGAGGGTCCC
TTTAGTAAGTGGCCTGCCGGTCATCCTGTGACTACCCTGTCCTCCACTAGTGGTGATGAC
GATCCTTGCAGAGTCCGGAATGGCACTGGTGGTTGCATGAGTGCGTTTCTCTAATTCTGG
TCGTCCTGCTGTGTGTTACATCTGTCAGAGATGGGCTTTCCCTCCCTACTCTCCCAGCCC
CCACTTTGCTGTTACTGTATATTCCTAGGTCATTTCTCCTTCAGTGTTTGCTCGCTTGCC
ATCAGTATTCTTTTCAGTGTGCAAATTGTCTCAGTTTGCAGGTCCCTTCAGGCTGGCTTC
TGTGTCCTTTTGCTATGTCCCCATCAGTTTCAAGTACTTTGTAGCTTTGTGATGCTAAGT
GATGTTCCATTTTTCCTTGAACTTTTCTTGCTCTGGACCTGGAATCTACCATTTATTTCT
CCAAGGGGCCCTGTTCCTTTTAGAGAGAGATTAAAAAATCAGAATATAGACGTTTCTATG
CCTTCCAGTGGCCAGAGGTAGAGGAGAGATGTGTGTCTGTGTACACGTGTACTTTTTACA
TACTGCACACATTCATGTTTTATGTACACACATTTATATAGATTAAATACACCGTGCTTC
ATGTTAGCAGTTGTTAATAATTAAAATGTTAAAATTCATTTGCCTACTTCGTATCCTTTG
CTTGCCCACATCACTTCTATACAAAAGGCAGAGAGAGATTACAGGTGCCTTATGAGTCTG
GTGAGGGTGCTAAGTTCAGGTTCCTGGACAGTGTCAGGAGGTAGACATCAGCTCAGCAAA
CACTGAGACTGTGCCGTGGGCCAGGTGTCTTGCCACACTCTGGTTAAGTGAAGGACCCTT
CCTTCCCCCTCAATGTCTTGTTTGTTCATTGGGAAACAACACAAACATGGCACAGGAGGC
CAGTGACTTTCATGAGGGGGCGAGTTTGGGCAGAAAGGCTGAGTAGGTTAAGGTGGAGGC
CCAGAGCGCTTGCCCATCTGGCACACTGGGAACCAGTGCGAGTAGGGGGCTTCCTGGGAT
GTGAGCTGGGCCACAAGTGCGCACTGATTTCCTCCAAGGGACAGTCACCTTGTCCCTGTC
CTTGCTTCTGGGCTCTTCAGGTCTGAGGGAGAGAAGGCCCCTGGACTGAGAAGTGAGGAC
ATCTTGGTTTGGGAGATTAGAGATTTAAACAGCTGAAGCAAAAAAATAAATAAATAAAAA
TAAAAAATAAAAATAAACAGCTGAAGCAAGAACTAGAACTGCCCTGGGCCTTCAGTGGAT
TGCTGACCCGCCTGCTCGGCTGAGTAATGGGGCCAGATGCCTTTAAAATACATTAGAAGA
GGTGCCTTGGTGGCTCAGTTGGTTAAGTATCTGACTCTAGATTTTGGCTCAGGTCATGAT
CTCAGGGTCATGAGATTGAGCCCCGTGTCAAGCTCTTCACTAGGTGGGAAGTCAGCTTGA
GATTCTCCCCCCCTCAGCTCCTCCCCATCTAAAAAAAATAAATTTTAAGTATTTTTTAAA
ACATGTTTTTAAGAAACCACTTGCTGCATTTAGAAATTAAAGTAAATAAAGCTGGGTAGA
TGTGCACTGATGATTTTCAGCCCTTGGCTGTTCCGTGTTGGGCATATTTTAAATTTTTGG
CCTTGTTTTTTTACTTCTTAATAGAAAAGCTCACTGATCAGGTGATGCAGAATCCTCAAG
TTTTGGCAGCTTTACAGGAACGGCTGGATAATGTCGCCCATACTCCTTCAAGTTACATTG
AGACGTAAGTATGCTATTCATGGGATGCAGTACAACTTTAAGAAACAAAGGGGAAAAGAC
CGATTTCCTGGTTCCTTAGAACAGGAGTAAGTGTCTTTTTTATTGAGCAGACTTTGGGTA
CTGAGAACCGTGCACTGGGTTCTAAAGAAGAGCCCCTGGGCTCAGTGGGTGGTAGAAGAA
CAGGCCTGGGGTGGGGGTAGGGGGAGAAGAGACGGCTGTGGGCAGGGCTCAGGGTGGGGT
GCTGGCTCCCTGCTGGCTCCCAGGCAACCACTCCCTGCTCTACGCAGGTGGACGTGGTGA
TACTGCCTGGGAGTAGGAGAGGTGAGGGATGATATGGGTCTCTAGTTTCTGGCTAGACTC
TGGCGGGTGGGTTGGCGTTTGTGGAAAGGAAATGCTGCGGGAGGGGCTAAGGTTTCATGG
AATAGAATTAGTTCCATGTTGTACATGCCATATGGTCAGTGCCCGCTGGGAGGACGGTGT
GGAGTTACTGTGACTGATTGGAGGACAGCTGGATTTAGGATAGTAGGGCTCAGTTTGCTT
AAAATCATTTGTTATTTTTCCATTGGAAAGGTAGAGTGAGATAAGAGGTTATTGTAATTG
TGTGATTAATTCAGAAAAGAAATATAGGTGTTCTGTTATGTCTGCCATTTCATTCGGCCC
CCACTGTGCTTCCACCTTACCCTGCCAGCAGTCCTAGAGACGGGCCTAGTTAAGTATCTT
GGTAGAGAACCTTTCCCCTGAGGTAGCTGTGGATAGGGAGGGTAGCAGGGGCCCTTTGTG
ATTTAAGGCTGTGCTGGTGTACTGTCTAAACGGTACTGTGCATAGGAGCAGCTGACACCG
TGCTGTGTGTTGTTGGAGGAAGGGTTGAGTGCCCAGGCTAGTGCTCGCCCTGCCTTCAGG
GCTCAGCCCATATGGATGCCATCCATGGGGGCTGTGGGGGCTGTGATGAGGCCCAGTAAT
CTGCTCTTTGTTGTACATAGTGAACAAGGGCTTCAGGTTAAACATATAATTTTGATGGGT
TAAAAAGGATTTTTTGCTTTTTCTGATTTAAGTAATGCATACAAACTGAAATATTTTTAG
AATACAGAAAGTACTGAGGTATCTGGGCAGCTCAGTTGTTAGTTGTCCGACTCTTGATTT
TGACTCAGGTCATGATCTCAGGGTTGTAGGATTAAGCCCCTCGTCCGGCTCTGCCCATCA
TGGACTCTGCTTGTGGAGAAGTATGAAAAAGCAAAGAAGCTCAAAATTACCTGGCTCTCG
AAGGGAACAGACCCCATTTGTCTGTGTCGTGTCTGATTTTCCCCTTAGTGTGTCAGCATG
AACCTCCACTGGGCGCTGAATATTCCTTGAAAACATGATTGTGGATAAGCTGTGCTTGTT
CAGTTTGTCGTTATTTCCAGTTTTTCACTTTTACAAATAATGCCTCAGTGGACATCTCAG
GCATAAGTATTTGGTTATTTCTTTGGTGTAACTTCTTGAAGTAGAGTTACTGGACCCAAG
GAACATTCAGGTTCAGCTTTGCTTGAAAGTGCATGAGTTGGTTAGAGGGCTTCTTTATCC
TTACTCTCATCAAACCTGGGAGATTTTTTTTAATTGCCAACTTGGTGAGGAGTAGACAGT
GGTTCTTCTAAATTAACATTCTTTGGACATTTTGTGGGATTGAACCTTCTTTCCATGTTT
ACCTGTGTTTTTTCTTTTGTGGTTTATCCGCCTGCATCTCCCTGCCACCTTTTGGGATGT
TTATCCTTCTAATGATGTGTAGGAGCTCGTTTCTATAATAAGGATGTTAATTCTGTTAGT
CTGAATTTATTTTAAGAAGATTGAAAAGCACGCTGCCTTACTTAGTGGACATAAGGATGT
TTGACTTTTCCTTTCCTCTCAGTCTGCCTAAAGCTGTGAAGAGAAGGATCAATGCACTGA
AACAGCTTCAGGTGAGGTGCGCCCACATAGAAGCCAAGTTCTATGAGGAGGTCCACGACT
TGGAGAGGAAGTATGCTGCGCTGTACCAGCCTCTCTTCGACAAGGTGGGCAGCTCTCTCA
TACGTTGCGTGTGCAGGGGCAGAGCTTTCTTCAGGGGAGACCTCCATGCTTATGGAGTGG
GGGACCCTTGAATGGTTATCCTTCAAACCCTAAGATTTAGGGTCTGAAGTTATAAAAGCA
TTGGGTATTCACAGATATTTGCAAATTGAATGAACTTCTGAGTTGCTGTAACTCTAAGAA
GGTCTCGTTCTTACTTAGAGAAGGGAATTCATCACTGGTGATGTTGAGCCAACAGATGCG
GAGTCAGAGTGGCACAGTGAAAATGAAGAGGAAGATAAATTGGCTGTGAGTATTTTTTTT
TTTTTGAATGAGTGCGTCTTGTGTTGTTTTAGTGCTATTAGGGGTAAGAAACCTGAACGT
TTTTTAATCCATGGTATGCCGTCACCAAGAACAGAGAGCTCCTAACTTTAGGTGCTGTTT
CACCCTGAGGTTGGTCCTTTAGATTTCCTTATGACTGGAGCACTGAGCAGCTGGCAGCCT
GGTGTCAGTCAGTTAATACCATGAACCAGATGTGATTTCCCTTCTCAGTCTAAACAGTTC
CATGCTGTAGGATAGTGAGATGTGGGATCCGACAAACAGAATTGAAAACTTCAGGAGATG
TCTTCCATCAGGACAAAAGCCAGACCCCACAAGGGGAGGGGACACCTCTGTCTCCACTCA
CTACATGGTCAGGGCCACCCTTCTCTAGGACTAGCAGTGGTAGTGAAGGAGCCACAGTGC
ACCCAGCCACTTGGGATTGGGAGCTTCTCATCACCTGCTCATAGTCTTCAGCAGATCCTA
TTCCAGTGTCGCAGAAAGTTCCAGCATGCTGTGGGGTAACTTTGTCCACCTGCTTCTTGT
TTGGAAGACAAGCAACTTATATTTTTATCCTTTTTATGATCCATTCCATCAGGATTATTT
TTTTAGAGAATTTTTTTTGAAGTGTATGTTAGTTTTAGTGACCGTATGTTTTTGATCTTT
CAAATATATTGTAGAACTGGCCTGGTTGAAGCTGTGGCTATGGATGAATCTAGTTGTGAA
TCATTTCCTTATTGCTCAAGAAAGATCTGCCTCTGTTAATTTGAAAAGCTCCTTATGATC
ATTTGTGCATAAGAATCCCATGTGATGAAGCATTTGCACTTAAAGTGGTTCCATTTAGTG
TTGTGCTTGACCTCCCTGGGCCTGCCCTTTCCCTGGGCCCTGATGTTAGAAATGATCCCT
CTGCACATGCTTGTCCAGTCATCTCCCTGATGTTTGCATGGGAGTTTCTGTGCAGACATT
TATAGCCACCTCCTTACCAGTGGATGTACACACCAGTTGGCGTTCCTTGTTGCCAAGGGC
ACTGGAGTCCTCCAGTCTGGGTGGCTGATTGTCCCAAGATGAACATCTCATAGAGCTGGC
ACTTGGCACCTTTCCCAAGTTTGATGGTATTGTACCATCTTTTAAAATTATATCACACAA
AAAAAATAAAAAAAATAAATAAATAAAATAAAATAAAATTATATCACAGAATCACATCTG
AATGGAATGCTTTGATTGCTTTGTTCCTTAAAGTCACTTTAAAAATGTGACATGCATGGT
GGTCTTGGAGATGCAGATGCAAAGAATACAGTTTTTGATAGAAGTGTGTGCAGGACTCTG
AAATTTACATTTTGCATTAAGCGGTTGAATATAAGTTTATTACTTTGTGGTAAGTGTTCT
GTTCTCTCTTATTTTTTTTAGGGAGATGTGAAAAATAAAGTAGTCATAGCAGAAAAAGAA
GCAGCAACAGCAGAGGAGCCAAACCCCAAAGGAATTCCAGAGTTCTGGTTTACCATCTTT
AGAAATGTAGATATGCTAAGTGAATTAGTCCAGGTAAGCAAATTTCCACCTAATAGAGTG
ATTTCAGTCTTAATTATTTATCTGTTAACCACTTAACTCTGTGTTTAGCAGTTGTTCCTG
GGGGGTGGAAAGGCACTTGACCAATAGCTCATATGTGTGGTCTTGATCTCCTGGGGCCGG
GGTCTCACTGTTAGAAGCCTCCATGCTACCTGACACTGAAAGTGCTGCTGGGAAGACCTG
TACCTCTGAGAGTGAGCCAGACTTGTAGTCTTCCTACCTCCATGAAGGCCCACTGCCTCC
CCCCTAGAGCACTTACCAACAGACTCAGAACCCTTCCTCATCTTCCTGTGAATGAACAAG
TGGGAAGATGTGAGGGCAGGAGACCAGGAAATTGGCCAACAGGGTCCATAACTTGCTGAC
CTAGGTGTTGTTTCTGGTTCTCTCTTCAGAGATGTGAGGACCAGCAGGCTTGGTCGATCC
TATATTTAGTGGCATCTAGTGGTAGTGTAAAAGCAGCTGGGCTCCTGCCCATCCTGCCTG
GCATTGATGGTTCCCAGTGCTCTGTGCCAGAGAGAAGTGGCACCTTGTTGCTGTCACCTA
GGCCCAGTGGTCCATGCACAGATTTGGGTGACTTCCTAGGAGCTCTTACTTGATGAGGCC
AAAATTCCAGCCAGGGCTGCTTCCCAGCATCTGGGATTGTGTCTGATGTCCAGTCAAAGG
GGGTAGTGTGTGTTGTTTGGAAAAAGCCCGCTAGAAATTTTTTTTTTCTCTTTATGATCA
GGAATATGATGAGCCTATCTTGAAGCACCTGCAGGATATTAAAGTGAAGTTTTCAGACCC
TGGGCAGCCAATGGTGAGTACTGATTGAGTTCCTGATTGGCATCAGAAAAGGTCAGGGCA
CTGAGGGTGAGGGGCTTGGAGCCAGGGTTGGGGATACAAACCTGGTCACACACTTGCAGA
GGATGGTCCTGAGGAAGATGCTCACCAAGAACTAGAATGTTGTCACGTGGCCTTCCTGGG
CCTTGCCCAGTAGCACTGCATAGCCTGACAGCCCGAGGCATGGGCTGCATGTGGCAGGTG
CTGGAGTCTGCAGCAGTGGACTCCCTTGCCAAGGTGTCTGCCACTTAGTTGCCACTCCCT
GAGCTAGCTTGTTTTCTGTCAAATGGGACAATGTCTTTGTTCTAAGTGTCTTTCAGGTTT
GTGAGGATCTAATGTCTGTAAAGCAGGATGGTAGGTATATACTCAAATACGAGCAGCACT
TTAATAGGAACCCAAGATGCTAATGAAAGAAGCCTCTATTAAGTTTTACCTAAAATAACC
GCAGGTAGACAAACCTGAAAAACGTGTCCTTGCTTTGACTGTCACAAAACAGCTCTTAGT
GGCTAGTGAGAGGAGTCTGACTGAAGCCAGCCCTTCCTTTCCTCCGGGGAATGGGGCCTG
CCAACCTGAGTGAGCTGGGTCCTCATAGAGGCACCATTCGTGGCCTCTTAGCCTGGCTGT
GGCTGACGGGCTCCATTCCAGTGTGACAGCAGTTCCAGCGGCACTTGACTGACTGCATCG
TGGCTCTCAGGTTCAGGTCCTGGGGACACAGCCTGGGACCTAGGGCCTGGCTCCTCCCTC
CCCATTGCAGAGCAATGGCCCCAGCTCAGGAATGAGGGCCAGTGTACGTGGGATGTCTCT
CCCTGCTCCTACAGGTACTTACTGGAGGCAAGGGGCAGGGGGATACCCTGGTTCTGTCCC
TTTCACTTCTCCTGCCTGGCTCACTCTGGGAGGTGACATTCAGCTTTCCCTCTGAGGGTG
TGGGGTGCTGGGCACCAGCTGAAGTGATGTCAGCTCAAAGGTTGAGGGGAACCCCTTTCC
TACTGCACCTGGTTAACCAGGTTATCAACAGGGCCTTCTTGTTGGTTATCAACAGGAGGC
TGGGCCATGGCACCCCCTGGAGGCTACATGGGGCAGCCCGAGCTTGTTGGCTTGTGTTTG
GGGGTGGGGTGGTGGTGGAGTGCATGCTCTTTTAAGATTCTGTGTCCGTTTTTTCCCCTA
ACACTTCTTTCTCACATCTATTAACTATTAATTTATTTTTTCCCTCTCGCTCAGTTCTTT
TCTTTTGTTCTTACAGACACTTGTTTGGTGATTTTCTGGGTCTGTTTTCTTTCTCAGTCT
GTCTGGCATTTTCCTCCATCTCTTACAGTGATTTATAGACAAACAGGAGCCTTAGTGTTG
GGAGACCACCAGCCAGTCTTCTTTCTCCCCCTCGTTACCTCCCCCGTTACAAAAGTCATA
CGCACTTACTGTGAGTGAGGAGGCATAAAGAACAACAATGCACATCTGTCGTGTAGAAGT
AACTCTCAACTGTGGAGTCTGTTTCCCCATAACCTTTGTCCTTTTAAAATTGTTATGAAA
TATTTTAGACATTAAAACTAGAACGAGGATGCCTGGGTGGCTCAATGGTTGATCTTCTGC
CTTTGGCTCAGGGTGTGATCCTTGGGGTCCTGGGATCAAGTCCTGAATCAGGCTCCCTGC
AGGAAGCCTGCTTCTTTCTCTCTATGCCTCAGCCTTTCTGTCTCTGTCTCTTATGGATAA
ATAAATAAAATCTTAAAAAAAAAAAAAAAAAAAGAACAAGAGATAAAAACTATCCAGCCT
CAGAATGAAGCAGGGCCATTGTGTTTGCTTCTCCCGTGACCACACCTCTCCTCTTCAGGG
TCTCCACACTTACCCTGTAGCAAAGAGGAATTACATCTGTGGACAATGTTGTATAGGCTC
TGCTGGGTGAGAAATAGTTATTACTGCCTCTGTGGGCTGTAAAATGATTTATTTAATGTT
GCCCACACATGCCGCTGCCACCTCCACCCTATTTTGAATTGTTGCATTATGATCAGCACA
CTTGAACCTAAATCATTTGTTCAAATTTTGGGTGGTTTCCTCAGTTTAGATTCCGTTTAG
TATAGTTTTACTGGGTTAAAAGAGGTGGACCTTTATAAGGCTCAAAGGTTCACTTCGCAT
ATTTTTTACACTTTATTTTTTGGAATCGTGTTTTTTTTCCCCTTTGTTTTGAAATAATTG
CAAGCTTAGTACCTGAGCTGCAGCAACAGTGTAGTGTTCCTGTGCTGCTTCTGCCCAGAC
TGGAGCTACTGGGGCCCTGTGGGCCATGCGGGGCAAGGGATTGCTTCCCAGGCTTTTCTT
TTTTCTTTTTTTTTAATTTTATTTATTTATTTATTTATGCATGAGAGACCGAGAGAGAGG
CAGAGACACAGGAGGAGGGAGATGCAGGCTCCATGCCAGGAGCCCGACGCAGGACTCCAG
GATCGCGCCCTGGGCCAAAGGCAGGCGCCAAACCGCTGAGCCACCCAGGGATCCCCTCTA
CTGCCTCTTGATTTTATTTGTGTCTGCTGCTTTCTACACACCCTGCGTCCATTGTTCCTC
TTATGCTTGTCTCTTCGGATTATACAGTGCTTTTGAACAAAAGATGAACTTGTCCCATCC
CTGCATAGAGGGGCCCCTTCACGCAGCAGAGAAGGCAGTGCTGTGCCTGAGCCCAAGTAC
AGAAGGGGCGGAGGGCTGGACCCCTGACGCCTGGTTTCCCAGTCCAGGCCCCCACCTCTG
TCAGGGTGGGCCCTGCAGCAGCAGGGAGAAGCTAGGGTTCCCTAGGAGAGCTTGGACCTC
CGCTGGGGAGGGTGCCTCAGAGGGGCACGCAGGACAGGTATTCCCTCACCTGCCATTTGT
GTTTTGACTTGATGCTGCTGTTTTTTGTAATAAAGATATTTTTCTTGATATGTGACCATA
CCTGTTGAACTTTTCAGTAGTGGTTTCTGTGACATTCTGCTCAGGGAGGAGTTGGTCTCT
AGTACATACCATGCCGTTCATAGTCTGTCACTGGTGGTCTGTAGACTGACCTGAGTTTTT
GTATTTAGTCTTTTGTATTAGAGTTCCACTTTGAACCCAACGACTACTTTACTAATTCAG
TCCTGACAAAAACATACAAGATGAAGTCAGAACCAGACAAGGCCGACCCCTTTTCCTTCG
AAGGTCCTGAAATAGTTGACTGTGATGGGTAAGTACATGCCATTTCAGCTTCTTTTTGGA
AATAAAAACAGATAATTTTAGAACTTAACGAGTAAGAGAAAATAAGAATAAAGCAAAATG
TCATTAATCTTCTTAAAAGCCCAGTGGACAAAGATTTAAATTATTAAATAGTCTTTCTGT
TTTGGGGGTATGACCGCCTGTGCTGGGAAATGTGTCATGGGGTCACATGTGCCACCATGG
GGGCTGGCGGCCCAGCTTCCTCATCAGATGGAGGGATTGGGTCCTCAAGCTCCCTTACAT
GACACTGTCCTCACTGAACTGATAAATGATCTTCAGTGTTTGTTGAGTGAAGAAAATGAG
TCAATGAAGGGCAGTATGGGTCAGTTGCTTGATTCGGAAATTGGTGGGGCAGTTTAATTG
TTATCTGACTCATGATGGAGCCCCTTGGTGACTTCAGGGGAAATCACCAGGAAGAGAAGG
TGGCTTGGAGTTCTTTCCCCTTGGTATGTTTGAGGTGGTTTGGGAAATTGTTTTGTCTTT
GAATTGGCACAATTACCTTACTCATGGGACAAGTACTTCTGAATCTTCCCAGATGAGCAG
TTCCAGAGCTTTCTTAAAACCTTTCTAGGCTCGAGTGGTGAGAGTGACTGAGAGAGCATT
TCCCAAGGGGAGGCTGTTAGGTGACACGTAGGCCCGGCTTACCAGGCATGTTCCCAAGCA
GACACCAGTCTCATGCTGCCAGGGGTTCCCAGTGGGTCCACAGTGATGGAGGGATGAGCA
GTGGTACAGGGTTTGCATTTGCACCCAAGAAGGCCCATTCAGCAGCCTGGAGCCAGTGTG
TCCACCCCAGACAGTCCTTTGTGCAGCTATAACTTGCTGCCTCTCCACCTTGTCCTGCCT
GGAGAATCCAGGTGTGTGAGTGGGTGACTTCAGGGTGCTTTGGGGTCTGGACAGAGGCAG
CAGGTGGCAAGCTCCTGAGCGTCTTTTGGGCCTCTTAGCCCAGCTGTGACCCGGCTTGGT
AATAGGAAACACCCTCCGAGTACTTGACAAGGGGAGGGGGCATTATGCCACTGTGGTCAC
AGAACCCCCAGCTTCAGGCAGTGCTGCTAGCCAGCGCGGCGGCAGCCTAGGTCACCTGGC
CACTTCCCTTTGTCCAGCCTTCACATGGACTTTGTAGATGTGCCGATCCGACTGGCAGGC
TGCTTTCCCTACCTACGTTGTCCAGGTCCTCTAGCTGTGCTTTGGTACCGTGGGTGTTTG
TGGTCAGTGTTTCTTATGGCCCGTGTCCGCATGTGTGATGGCTGTCTGTCCCCATAGGTG
TGCTATTGATTGGAAGAAAGGGAAAAATGTTACAGTCAAAACAATCAAGAAGAAGCAGAA
ACATAAGGGACGAGGCACAGTGAGAACAATTACCAAACAAGTTCCCAACGACTCTTTTTT
CAACTTCTTCAGCCCACTGAAAGGTGAGTGGGTTGCGTTGCGGATGGTGATTATATATTA
CGGGAAGTCCTTGCCTTACCCTTAGAGTCCGGTGCAGGTCCTCTGGTGAGTGTGACTGCT
AAAGACACAGTTGCTATGCTAGGGGCCGTGGTGCTGGTGCTCACAAGGTGCGGAAGTGGT
AGGGGTGGAGGGAGGGCTCAGTGGGCGCCCTGAGCTCCATGCTGGCAGGCCTTCCTGCCA
CAGCCCTGCCTTTGTCCCTGGTTGTACTCCAGTTACACCTATGCAGCTTGTGGATCATTC
CCCACCCTCTCTCTTATAAATTTAGTTTAGTTTTGTTTTTCTCTGTGACTTGATACAACT
TGAGGGGTTTACAGATCATGGATTTCTGTTTTTGAAAGACTTAGCTTGGAAACTAATTTT
TTTTTCCACCTAAGTAATAAAATAAAGTGACCAAGTGAAGGTTGAGCAACAGGTTTTGAG
GGTAAATTACTGAGAAGTCTTAACAAAATTTTTTAAACCTGAACGTGAAGGCCAGGCGGG
TTGGCAGTGTTAGAATAGGAGAAAACATGCTCTCTTTATTTTCCGTGAACACGAAGTGAT
TGAAATCTAGAACTGCCTGCCCCTGGCACAGGTAATTGGTGGGTGTGTGAGTTTTTCTCC
CTTGCCCACAGGGTGGCTCCATTTTTAAGTGTGAGCCTCAGACCATGACTTTGTCTCTGA
GCTGAGGGCCCTGGCTTCTCAGGCTACGACATTCGCCCTTCCACCCTGTATCTTTCTGGG
ATTCGTCTTTGATCCTAGAGGATGCAAATGTGTATTGGTTTGGTGGTAACACTAGCCAAA
AATGTAGTTAAGTTTTTTCCTTGTATTGGAGAATCCCCTTTGGTGGTCACCTGCATACAT
TCTCCATGAAACAGGGGCTTTGGTTCCTAAATGCAGTGGCTTTGCTGGAAGGTTTCTTAA
GATTGGGTTTTAAGTAATTTAATAATCAAAATGAAATTAAGTGGACTCAGAATTTGGGGG
GGGTGACTTTTGGGGTTCTAAAACTGTCCTGTGATGGTTATGACTCTGAAAATGTCCTGG
GGTAATTAATGTACACTTAAGCTCTCTGGTAGATAAATTACATGTAAACATAGCTATTTT
TAAAGTCGTCATGTATGATATCAAGTGATGAGCTCTGTGAAAACAAATCAAAGGTGACCA
TAGTAGTGACAGGGCAGGCAAGGAAAAGGTGCTGAAATTCAGATAATGTGTTTTGAAATG
AAGGAATCTGGTCTGGTGCCCTCCTTGTCCTTAAATCTATAAGACCTGTCCCAAAGTCAC
ATGAGCAAAGTCCTTGGCACCCAGGCCAGAGTTCCCAGACCCAAATCTTAGCCTGTGGTG
GTGCGCACATGCCAAGGCTCAGGGAACATGCTATAGGGGTGGTGTTGACACACATGGGTG
CCCAGCCCCTGGGGAGCAGCCAAGCCAGGAGGGGCTAGTTGAGGCCAGGGTGGTAAGCCT
CCCGCTCCTGGCAAGACTGAGCCTTGAACAAGCATTTCTAAAGTCTGGGTTTTGAATGGT
GGTGGTTAGTTGAGCATCACTGGGCTTTGTTGAGTGGTTTTAAGTTCCTGTATTTGCCGT
CACTCTCGGTTCTGGGTCAGGCTCTGGTGCAGCAGCAGAGTCTGGCCAACTGTGCGCGCG
CGCGCGCGCGCGCGCGCGTGTGTGTGTAATTGCCCCTGTGCTGCACTCTTTGGTGGGCAG
CGACCAGCAACACCCTCTTGCCCACAGGGAGTCTTTCCATTGTGTGGGAAGAATGCTTCA
GCACTGTGTTCTCTCCTTTCTCCTTTCCAAATGGACACAGTGTGGACCCTACTGAGGTGC
AGTGCTTTAGAAACAAGGCTCAAGGATCTTCCTCCCCCGAGAGAATCCTGCAGGGTTGCA
GGACACGGGTACAGTCTCCTTAAAGTGTAAATGCGCGCTGAGTGTCCACAGTCTGGAGCC
ACTTCATAGGCCTTTCCACCTGCTACCACTAAACTAGGAAGGAAAGTGCTTTTCCCCAGT
TGGCGTCCTGAGCAGGTTTCCGAACAGGTCTGGTGGGGGCCACAGGGAGATTAGGGGCTC
CAGCTGTGCATGGTCCCACCTTACCTCCATGGATCTGCCTGCATGGGCTTGCAAAGGTTT
TGGTTGTCAGTGTAACGTGCGTATGTTTTGTCTTTTTTTTTTTTTCTAGCGTCTGGGGAT
GGAGAATCACTGGTAAGCTTTGTGTTGTCATCAGAATCTCATTATCTCCAGAGCAGTTGC
CCACCTTCTATTCAGTCCCTCCTCCCTCCTTAATCCTCTGACACCTGGGGTGTGCGGTAT
TCACTACACTGTGGGGCGGAGCCCCGTGTGCTCCACCACTCTCAGTAATGCTGGGTCCCC
CAGAGTGAGGGACACGGTGCGGGTGGGGGGCGCGGTGTTCGCCGGTGGACACAGGTTAAC
ATTGGGGTCTTACCTCCTCAGGATGAAGACTCGGAATTCACATTAGCCTCTGACTTTGAA
ATCGGACACTTCTTTCGTGAGCGGATAGTCCCGCGGGCTGTGCTGTACTTCACAGGGGAG
GCCATAGAGGATGATGACAACGTATGTGGGTGGGAGACCCTGGGGGTCCCCTGGTGGCGG
GGGAGGGCGGACAAGCAGGGCTCTGGGGTACTCGTAGAGCAGAGTGCCAGCCCCCTCCAG
GGACAGCATCCTCAAAAGACCCCAGGTGCTCATCATGTCCTGCTTAAGGTCTATAAGCTT
TGGGTGACTTGGAAATGGGAGGAAAATCTCATTTACGGAAGTCTGGCCACAGCAAAAGGT
TAGGATAGAGTGGACTCGTGCTAGCCTGTGGTGTGCTGGCCCCAAAGAATTGAAACCCAT
GGTGCACAGAAGGATGGTGTGGTTGCAAAGTCCCCTCCTTCCTCTCTCCCTGCCTGAGCA
CAGCCTAGCTGGCTGGCTTTCGATGGTCACCTGAGATTGTTCTTCATTCCAGCCTGCGCT
CGGCTCACCGTGTCGTCTTGATTTGTAGGAATAAAGTCTTATAGTGTGCTGTTAGAAGTA
TGCTTCAGATATTTATTCCCTTGCTTTTAGAGCTCTTAGGTTTCCTGGATGGTTCTCAGT
TTCCTTTCTAAGACGTTTCTCAAGGCTTCAGATGGGGACAGCCAGAGCCAGGCAGGTTTG
AGCTGCTTAGTGCCCAGGGGCAACGAGGGCCTGCTCCTCGCACTTCTCCTTTGTGCAAAT
GGGCCCATCCAGAGTGGGCTGGCTGTGTAATCTGGAACTGCTTTGTCTGTCCCTGGGCTG
GGAGGTAGTTTTGGGGCAGGCTGACATGGACACGCACAAGTCAGTGTAGTGTTGCCTCGT
GTAAGTGCTCAAGTTATTAAGTTGACACAGCAGATTGTAGACCAACACAGTCCCGTAGAA
CTTTCTGTGATGATGGAACAGTCTTCAGCGTGCCTGCTCTGTCCAGTGTGGTAGGACTGG
CCCCATGTGATGCTTGAGGATGTAAAATGAAGCTCTAGGCAACTGAGGTCAACTGAGTGT
TTAGTTTTTATTTAATGTAGCCAAAACAGTCTAGTGATGACACACAGTGGAAATCTCTAG
ACTGCATGGTCTCCACAGTTTTGATCATATACCCATCAATTTTAAAACTCGAACGTGCAG
CTCATTATATATTGGTTTACTTCAAATGCATGCAGAGTGGGTAGTACTGGCTAGGACTGT
GTGTGTATTCACTCACAACACCTTTTGTATGGGTGCTGCTGCTGAGCAGTGTAGTTTAGA
GGTTAGAAGGGGGAGCCGCACTCAAGACTGCTTATTAGACCAGGATCCCGATTTCACCAC
TCATAGCTGTGTGGCCTCTGTGCTGCAGTGTCCTCATCTGAAAACAGGGTTAACGGTAGA
CTCTGGTGACTTGTCAGGCTCTCTAAAATAGCACCTCTAACAAAAATTTAAAAAAATAAA
ATAAAATAGCACCTCTTGGCACCATTACATAGTGCATGTTAGGATAAAGGTAAACTTCAG
GTGTCTGCTATGTTGGAAACCTTGCACAACAGCTGGACATTGTTGCAGGAGGGAATGGGT
CTTCCACGTTCTCTAGGCTTAGCTTGCTTTTCCCATGAGCTCTGCAGTCACTGTGGAAGC
ACTGTTCTACGTCACTGTGAGGTGTGTTTGAAACAGGACCCTCTAGGCCCTTCCACGTCA
AGAGTGAAATGATAATACTTAGAACCTCAGAAGATCCACGCTTGAGCCTGTTGGAGGGTA
GTTCCAATCTGAGCTAAAATGTAGTTCCCTACAAGACATCAGACCAAGGTCTTTCCCTCT
CGGAGGCTGAAGGGCACTGGGGGGTGTGTGGACCCCACCAGCCCTTAAGCCCTTAGAAGT
TTTGTGTGGGCTGTCACTAAGGACAGGCTCCAACGAATGAAATGTTTGTAAGAAAAAGCC
TACTAAATTTTTATGTCCCTCGTGGCGTTCAGGCAGTAACGATAAGGTTTGTTTTGTGTT
TGATCTTGTTCTGAGTCTGATGTGTGGAGTTTGAATGAGAGTCTGACCTGTGGTGTCTTT
GGACCTAGAAGAAATTCATTCACAACCAACCAACTACAGTGTTAGGCTTCTCTTCACACT
TAAACACCAGGGTTTTATCACATTTCTAATAATAAATACCCTTGTAGGAGATATAAAATA
CTACTGGAATTCATGTATCTGCATAGTAAAATGCTCCTGTTTGGCTTAGATTAGCCAGTT
TCCCAAGGGGTCCCAATATGGTGTCATGATGACCATCTTATTCCTGCACCCTTCCCCATC
CTCAGGCCTTGTTTTGAGTGGTTTTCAGATACCCAGCATCCTATGAACACAGCAGGCCTC
ATGGCTAGATGGCCCCACAGCATCAAGGGCCAGGATGCCCAGAGGCTGGGCCATGCTTCT
GCTTCCCACAGGCCTGACCAGTGGGGGCACTTGACAGGGACTGTGCCTGGGTCAGGCTGC
CCTTGTGCTTTAGAGACCTAAATCCTGTTTCCTTTCTTTTTTCAGTTTGAAGAGGGTGAG
GAAGGAGAAGAGGAGGTAAGACATGGTGAACGTGGAGCATCTTTTCCCTGAGGCTGCACT
AGGCTTCCCCTGCCAGAACAGTTGGAGGTCATGGAACCTTGTGTGGAGCTGCCTCGGGGC
CTCCACCCTGTTGAAGCCAGTGGAAGGGGGTGGTGGACGCAGGTGCTGGCCCTCTGCCCA
GTCGCCAGCCCCTCGATTGACTTAGGAAATGTTGGTTTAACAAACAAATCGCATTTTCAG
CAGTGTGTTTATATCCATTATCACTGAGAACAAAAAGGTGCCTAGAAATCATTGTGTCCA
GAGGAAGTGACCTAAGCACTTAGGGACCGTGATCATGGATTTCCTGCTGAATTCGAGGGT
GGCTTTCATTTGTGTGGAGTGTGTGCAGATCCACAAGAGTTTAAGTCCCGTGTGTTCAGC
TCACTCTCATCCTTTTCTGCAGGAGTTGGAAGGTGACGAGGAGGGAGAAGATGAGGATGA
TGCCGACATTAACCCTAAGGTCAGTTGTTGGGGAGCTGCCGTGTCCACCGATGCCATGCT
GCTGTGCTGTTGGGTTGTGTCCCCACCTGGCGTGCCTGTCCTGCTCTAGTTAGAACATGG
AAAACAGACCAGGAATAGGCATGAGTAGCCCCTTCGGTAGGATTTAGTGCTCGGTGAGTG
TCCAGTGAAGGAAGGCTTTCCAAGCTTACTCAGAAGCTCTTTCTTTCCATAAGCTATTTC
AGGAGAGCAGCTTTGTTTTCCAGACCCTTAGTCCTTTCAGGGTAATGGCTGAATGACCAC
ATCAATAAGCTGCCATCTATTTGTTTTTGGAAAAGGTATAAAGAAGGAACTTCGGGGGGT
TATTTTTTTTAATAGAGTAATTGAATTGTAGACATAATTTTGTAGTTGCCTATGGGCTGA
GAATATTCACAAGCTATGTCTAAATACCTCTAATCATTGAAAGTAAACTAGGAAGCATTG
CTAAAAAAACAAAAACAAAAACAAAATGAGAGTGGCAACCCCGTTAATTTTACCTGAAGG
TCTGAATGTTTACTGATGGTCAGATCAACTTAAATGAAGTTGCTTTGCCACTTAACACAT
CTCTTAAATCCAGAACTGCTTTAATGTAGTCCTGAAGCTGTAGTATGAATGTCCTCTGTT
TGCTAGCATGAGAAATTGAAAGCTCACTACATCTTAGTATTAAATACATCACAGGCTGTT
GGAACACTCAACTGACCTGCCATTTATAGCCTGGGTCTCGGTTTAACTAGACATAGTTTG
TCCTCCGTTTTTGCCCAAAGTGGAATGTGCACTAAACTATCAGTGTAATAACCCAGCTCT
GTAAGTGTGTGTGTGTGTTTGTTTTTTTTTAACACCCAAATGTTTCTGTAAATGCATGCT
TTACAGCTCCTTCTAGGGAAGGATGAGAGGTGGGTTTAAGACTTTTTTAAATGTACCATA
TAAATACTGCTTTGGGAATAAGCCTACAGACATACTCACCTCTGCACAGTTGGCCTATCA
CGGGAGAACTGTAGTGCAAGCACCCCTGTGCTCAGCTCTGTAACATGGGGGCCCTGCCTC
AGGTGGCTCACACTGGGCGAATGGGGGAGGTGCTGACACACACATTCATGGTTTGGATTT
GAGAACAGAGACTGAGGATGGTTTGCAGGGGGAGCTCCGTTACTCCGTCGCTTGTCACTT
CCTTCTGTTGTTTGTCCTCTTCTCTCTCCTTGCCAAACCTGTCTCCTGCCACGTCTGTTT
TCTGGAAGGGCATTCTCTCACAAGTAATCTGGCACAGTATAGGGTTGTCAGGACTGGCGC
TCCGTGGATCTTCATTGGTGGGGCACAGGGGTGGGATGATAAACTGGGAGGCACCAGGAC
CGCCAGCCCTGTGCAGCTAGAAGGGCCCGGGTCTTGTCTTTCAGAGGGATTTGTTATATC
TGAGTCTGCACACGTGGAGGCAAACAAGGGAGAAGGGATGTTTGGTGTTAAATGAACAGC
TGTGGTGGGTTGGGGTTGCTCATCTCAAGCTCAAGATTTTGTAGTCAGTCGTGTCATGAG
AAAGTGGCTGTTTCCGCCTGTTTAATCTTGTGCATTTTGCTTTCTTTTTTGCTGACAGTT
CCTTTCAATTTTTTCCCCATTTAGGTGTAATTTTTGTCTGTTAATCATTCATGCGTTTCT
AGGTAAGGTGGAATTCCATTCATTCCTAATCCAATCTTCTGATCTGTGCTTTATAACAGT
GCTTTATTGTGACTTTGTGGATAAAGAGGAAGCTGTTGGCCAGGCACACTTCTAGTGTGC
TAGGCTGAGCTCAGGGCTTTCTGAAGAACAGTATTTTTGCGCAGGTGTCTGTTGTATGTA
CTCCTAAAACTGATCGTCAGAAACTACATTTGGCTCCTGTTGCTGAGCCCAGTGTTTGTT
GCTGACCACGGAGAGGCGTGACTGGTGTGGCATTTTTATTGGGGACGGGACTGCCCTCCA
GGAGGAGCACAGAGCGTGAGGGCCCTGGGAGGTGGGCACTGTGCAGTCTTCATGAGGACC
GTGTTGCACGGGCCACCCTGGAATGAGCCACACCTGTGCAATAGGAAGCAGCCCACTGTG
CTTTTTCTTGATGAGTCTCGATTGATTGTTTCTACTTTTTAAATTCAGGTGTGGTGCAGA
CCAGTAGGTCATTAAGGGCTAGCTGACCTTTGAATGTGCTAGAGTTACTATCTCCAAAGC
TGTGGTATCTATGTGGTTTAGTGTTCGGAGCAGGTGCTGTTGCGTGTTATTGGGAGTACT
CTGGCTGGGGAAGAGCTAGCTGTGCCCACCTGCCACCCCTGTCTGCCACAGCATGGGCCA
TTGCAGCTCTGTTCCAGCCATCAGCTCCTCGCCCTTGGGGAACACTGTCCTCACTTGGGG
GTAGGGGTGGGGCGCCTGGTCAGAAGGTGCCACAGGAGGCAGGTGCAGTGATGTTCATCC
CTGGAAATGTAGGGGTTCTTGGTGCTGTGCTAAGAGCAGCGGCAGTCAGTGTGTAAAGCA
GGGCCTGTGAGAGCTAGGACTTGAACTTAAGGCTTCCTGCTGATCCTGACATTTAAGCAG
ACCACAGGCCTTTGAGAGTCTCTCTGCATTGCCTTCCTGTCTGCTCACTCGGGTGGGCTC
ACATAGAGAACTAAGAGGTGAAGAGGTAGCACAGCTATCTCCTGGTTAAGAAACGTCATA
ACTAGGTGAGATGAAGAGACACCTGGATCATTTACATGCATATAGGACAGTGTGTTCTGT
TGCTCTTGATTGATTCCTACTGCCCCACATGTCTAAAGAATTGACCAACCAGGCTTGCTC
CCCCCCTACCCCTCTCTCACCCTGCCAGTCACTGGGAAGCATCCTTAACCTATTCAGCCT
GAGTCTCTCAGACAGGGGACCCTCCTGGGGTGTAGTCACCGTGAATAATACTGGCACGTG
ACTGCAATATCAGCCAGCACCTCAGTAGTGTCATCAGATCCTTGTCAGGGGCCCGGCTTC
TCGGATGGGGGAGGCCATTCCCTCCATAGTCACACAGGCTTTTGGGCCCTGGCTGTGTTC
CCCTGTGAAGCTGTGCTGGTCAGCTGTGTGCTTGGTGGCAGTTGTCACCTGTTAAAATTT
GGCTTTTAAATGGCTCCGTAACAGGCAGGTTTGAGTTGTTAGTTTGTGCCTTGGAAATAC
CCAAGTCCTCTCCCTTGATAATCAGTGGCATTAAGTAACCCGGCTGCCATTGGACTTTGT
GGCCTGAGACAGAGGATGCTGGGTTTAGTTGTCATCCTGTTTTGGCCTGTGTCACAGGCT
GAAAACAAGTGTCTTGTTGATAAAATTGACATCAGAAGCTTCGGGGTTCTGTGTTGACTT
TACAGCCGAGGGCCCGTGTCCGTGCAGATGCTGTCCTCAGCTGGGCCACCTGCCTGCCTC
CCTGCCTGGCCCTGTGCTCTCCAGCAGACTTTATCTAAACCCCAAGCTGCTGAAGGTATC
TTAAACAAATAGATAATACATTCTCCTGGTTAAAAATAAATATATCATTCAAACAGCATA
TACTGTAAAATGCCCAATGTTGTAAAACACTGTATGTGTGTAACTCACACGTATTCAGGA
AGGTGTGCTGCCTGCCCATTCCCATGGTGTTCCCACTTCTTAGCTCCATCTTCTCTAACC
CACCTCCTTCTTGGAAATACAACTGTGGAAACACACACTTCTCCCCTCCTCCTCAAAACG
TTGCCAGCTACTCTCCCACCCCTGCCATGGCCATACCAGGCTGGGAGCACCTCCTCGCTT
CTCCAGCCAGGCTTGAGAGCCAGTGGGTCATTTCCTTGGCCGCTGACCTGGGTTGCCTCC
AGATCCACAGTTTGAGTTTGATCTTTTCCAACCTGGATTTCTGATCAGGTGTGTTTTGTT
TTGGTGCCTGGGTTCTTCAGTATTCTAGATGAGCAGGACCCCCTCCCAGAGTGTCCCACT
GCTGGGCGGTGCTGGGCAGAGACCTGGGGCCAGTCAGACCTGGTGGGTCCCAGCGATGTC
TGTGTGCTCTTCCCTTTAGACTTCCAAATAAAGAGCTTATTAGACCAGGGTCTGAGATCA
TGGTTGTCTTTAGGAATCCCTTATGTGTAATTTTCTTTGTATCTAAAATGTGATTTCCCC
AAGAATGTAGTCCCAGCTCCAGTCATAGAAGGTGTCAGTTACTTTATCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCAGTAAATGTATTTACTCAG
AATGGTTAGTAATCTCGTCTGTCTCTCAGGCTGTGTTTGGCCTCCGCACAGAATGCGTGG
GGTTGCTGACTGCGCTTTTAAACGGTGTGAGATGTGTTAGGTTGTATTGAAGTGGATGTG
CTCCTCTGGGGGCGGGGGAGGCTCTCTCCCTGATACCTTTCAGGAGGGATAGACATCCCA
CTTGGGGAGGGACTGGGAGGATCAAGCCATGCCTGTGTGGAGCTGTTGGAGTGGCCTCCC
AGCTGTGGTCTGCTGGCACAGCCCGTTAGCAGAGAGCACTCTGGAGTGCTGGCAGGACTC
TGGGGCTGCTCAGCTGCCTCTGGCCCACCCTGGAGTGGCACTGTTTCAGGTGCTGAGCCT
GTCTTAACGGGAGGCGAGGAACAGAAAAGGGAGCCTGCTGCTGTCACGTGGGCAGGGGCA
GGGGGTTGCCCGAGGCTCTGAGGCTGCTATGCAGTGTTGGAGCATGGGCTCCCTTCTGCA
CTGAGTCTCCGACCCTGACACGTTCCTCCTTCCCAACACACGGGCTGTGACTTAGACTTA
CGGCATGTCTTGAAACCAGAAAGGCTGCCCTACTGAGACTTTATTTCTGGGAAATTGACT
GATTTTTTTTTTTTTTTTTAATTACAATCTTAAAAGTATGTTTGCAGTAACCATCGTTTC
AGTAAGAATGAAGGCAGTCAATTGAGTCTTGGTTTGCATTGTTGGTTGGAGATACCTGGT
CGACAGCATTGGTTCCCTACAAGTCTTGTCTTCTCTCGTTGACAGAAGGAGCCCAGCCAG
CCATCTGAGTGCAAACAGCAGTGAGGAGTGAGCGTCCTGCAGGTGCGGCGTCGGGGACTG
GTCATGGCGGCGGCACCACCGTATTGGCAGTGCTTCTAACTTGTTTTCAAGTGCATGATT
TTGACTTTAACTTTTCCTTTATCCTTATTATTTTGCTTAACCTGTACAGTGGCAACTTAA
ATGCATTTCAGAAATAGGAGGTTTGATTCCAGCACCCTCTATGGCCTTGGGTGCAGTGCA
GCTCAGTGGACTTTCCCAGGCCCTGCCTTCCGGAGGGCTCTGTAGACCCTGGGGGGATGG
GGTGGTGGAAGGTCAGTTGACGCCAAGGGCAGTTGTCTGGGGATGTGGTTCCAGGGCTTC
TAGAACCAGTCACACCCCTCCACAGCCAGACTGGATCCTTCTTCACTTGAAGAAACCCAT
ACGCTTTGTGTTTGCCACCACTTGGTCTCCTGTGCTCTAATCCTCTCAGGAGAGCTGATA
GAGTAGGGTCCTGTTCTCCTTAGAACGTTCTTTCTCTGGTTTTGTCTTCCTCAGGGTGGG
GTAGGGGTTGTGGTGCACCCTAGCCCTGAGGCGTGAGCATTTGTGGTTCATCTTTGTATT
TATTTATTCTTTCCTCTTTGTGAGGGCTTGGGACACATGCTGTCACTTGTCCTTACAGTT
TCTGAAACCATGTGTGTGACTGGTGACCTGGTGACTCGCCAGGTGGGTGTGGTCGTGGCT
CCCAGGGAGTGAGGCCTGTGTAGAAGGAACCTCGCTCTGTCCTGCCTTCAGCTGAGGGCA
GGAGCTCGTTTCCACGACATGCAGACCACACGGCTTTGGGGGGCGGGTTGCGGGCAGAGT
GCCGGGGTTCACCAGGCTTCTGTGGTGAGAGGGGCCTAGGCTGGGAAGCACTGCTGTTAG
TGTGTACGTGTCAAGTCTTGCTTTGTCAGTACCCCCATTTCTTGGCCCCATGCTCATCTT
GTCTTAAAAGCCCTGGGTTCAGAGTGACCTGTTTTTGGCTGGCGTGTGGGGTTTCCGAGT
GTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1868..1926, 4704..4803, 6682..6823, 7038..7124, 8541..8672, 9421..9492, 12548..12687, 13977..14122, 16309..16331, 16581..16700, 19125..19154, 19582..19638, 24765..24803
1001..1014, 1868..1926, 4704..4803, 6682..6823, 7038..7124, 8541..8672, 9421..9492, 12548..12687, 13977..14122, 16309..16331, 16581..16700, 19125..19154, 19582..19638, 24765..24800
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved