Canis_familiaris Locus RPLP2
snOPY snoRNA Orthological Gene Database
Canis_familiaris RPLP2
Canis_familiaris
RPLP2
18
SNORA52
1729..1861
3682
agacctgcctgcacccaactctgtgtacgatggggtgatgaccctgagggcaccccaca
gcagggagacctgcctgcacccaactctgtgtacgatggggtgatgaccctgagggcacc
ccacagcagggagacctgcctgcacccaactctgtgtacgatggggtgaggaccctgagg
gcaccccacagcagggagacctgcctgcaccccacctctgtacgatggggtgatgaccct
gagggcaccccacagcagggagacctgcctgcacccaactctgtgtacgatggggtgatg
accccgagggcaccccacagcagggagacctgcctgcgccccacctctgtgtaggatggg
gtgatgaccctgagggcaccccacagcagggagacctgcctgcaccccacctctgtacga
tggggtgatgaccctgagggcacccccccaggactgggccggctctgctcctggtccctc
tccagtccccgcgggcctctgcccctggcccctgaccccggctcgccccaggtcttcggg
ccgccgccgcctcccttccgcgtgcagcgttattactctcgtgcatcctcgctcggacga
gcaggggcgggccccgccctcgcagcgccgcaacctgcaggctccccgcgcggagcgtga
gcgcgtgacggggcggacatcggcgcggacgcgaaggtcagctcgggcccacgcggcccc
acaggcgaacgaccaccccgcgcaggccgcggcccaacgccccacccccgcagcagcgag
cgagcctggccggccacgtgccccgcgcaggccgcgtgcccgcaaatccggcagcggtgc
gccctgggacttggagtccgccgagggcggcggcgtcgggacggcccaacgagagggctc
tagtctccgaggcctgggcgagcgtgtcgtcgctagcaggagtcagcactgcacggcgcg
cgggtcccgggggctttggggtagcggatttcccccgccccTGGCGCCGGCGCCTTCCTT
TCTGTCCCTGACGCCGCCGAGGTCGCACGCGTGAGGCTTCTCCGCCGCCGAgtgagtggg
cggcggggtcgcggggggccgaggggggcggcggggggccgcggggactggcgggcgcgg
gccggggcttggcgtggggcgccgggcgggagcacgcggggcgggggccggggccaaggg
gcaaggccgtcgtgctctcctcccgctccagGATGCGCTACGTCGCCTCCTACCTGCTGG
CCGCCCTCAGGGGCAACACCTCCCCCAGCGCCAAGGATATCAAGAAGATAGGGGACAGCG
TGGGCATCGAGGCGGACGATGACCGGCTCAACAAGgtagccggccccgcggatacgtgtc
ggcagcccgaagggggggtgggcgtcccctgagaccctgtcgtgtgtcccgaggggcgca
gcttcctcaggcacgtccttctgtccagcccgcaggtgtccagccgcgccgggggcgggg
gcgtacaccgagacctcagggcgggtttcccaggaagcttagggcgtcccgggcccctcg
tagcgggtcttctcggggaggagccgcatgggagttgaggcaggggccggtggccgagcc
ccaggtaattgccggttatggtcgttgtagGTCATCAGCGAGCTCAACGGGAAAAACATC
GAGGACGTGATCGCTCAGGgtgaggttgtgcgccggggctgcgttctcagggtccatcct
aatccctgcgggtcctcctgtggcccgccaggtttcgcttgtggaccagagcactccaga
agcctcacccaggacagcgggcaggcttcagtggctcgtgccagggatgcttctggacag
tcctggccgtagggcagcagggggtgctggtgctttcaccccgcagggccacctgcctgc
agaggggaccttagggatcttgggaacggggttttgtaaataagtctcgtcatgtagtct
gcgtgaagtggttgggggcagactgggggtgccaggggtgaccgcaggttcctgccatcc
ttgctgggcagatggtgtcctggtgacaaagctggagctgatgggacattattctgttcc
tgtgtggggctgggtgggtgccttagcccacagccctgtgggagcccataaacggggatc
tggatccaagtgccagattgtgtctttgcctggttgtgaacatatttgtccaacttagct
ttggggtagggtttccatatacggatctcagggctggggcatctatgtggtgggcttccg
cacatcggggagaccatgccatcactcccctgaggtaggcttaaggccgagcacttccct
ggtctcaccttcctgattcccacagGTATTGGCAAGTTGGCCAGTGTGCCTGCTGGTGGG
GCTGTGGCCGTGTCTGCCGCCCCAGGGTCTGCAGCTCCTGCTGCTGGTGCTGCCCCAGCC
GCAGgtaagtggaggctgaggcagggtctccacgggcatctggctttgtgaggggtgagg
gttgtactcactgcccccttcttttccacagCGGAGGAAAAGAAAGATGAGAAGAAAGAG
GAGTCCGAGGAGTCAGACGACGACATGGGATTTGGCTTATTTGATTAGGGTCCTGCCCAC
CCCCACCCACTGGCAAATAAAACCCTTTTTGTGTATCTGTGGAgtggtgtgtgggtgttt
tgtaagagtgtggcgttggtgcgcagggcaggccttcagcccaagagaaagcagagccct
tgctgcgcaaggagcagggcatctggtgtggaaatgggtacttgggatggcagacgtctg
tggctcttcggtatggccgggccttgaggaggctcagaaggggacatgagccttcctggg
catgggcctggtttctgagggctgctggggggccttcccagagagggagctttaagggga
cacacaggacaacttaaagccgcagtgggtagtctccactgctttggggtggctctggct
ggtggaggccagcagtcgccctgaggcgggtagcattctttggttgcacaaagagggcat
gctggtggtgcatgcgggatccctcagtttctctgcagagtccagtccggttcttgttca
agctcagggtggtccatgagcaacttaggacagtcccaaacaccttcaagctctgtgacc
acctgtctgcaggcctgggcagatgtggatgtggctcataggaagtgatgttgggccatg
tgcccactaagttctttgggggacctgcttatgcctcctgccaggctctggcctggaatg
caggggcagaaggcagagtttcccacactgcttgtccagctgccatgctgggccctgggt
cctctgcctgccaatgccagacggctcagcaggcgctctgcctccttgtttgaaggctct
gggtggacctattgtgttgcctactatatcccagaaggacctgctgctagtgggctgtgg
ttctgtagggaaagcacagaacgaggctgtcaaggaagcctgggaagggggcctgcgggg
caggagtgtgcatggggtgtgggaaagaaggcctaagtaagccctttggttacccagagg
gatgggaccctggtgcaacgtgggccgtgagcatcactggcagcctgtgctgcaaggggc
aagtgagagcaggggtggggaga
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1231..1354, 1650..1698, 2365..2463, 2551..2682
1232..1354, 1650..1698, 2365..2463, 2551..2627
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved