Canis_familiaris Locus ENSCAFG00000013866
snOPY snoRNA Orthological Gene Database
Canis_familiaris ENSCAFG00000013866
Canis_familiaris
ENSCAFG00000013866
13
SNORA72
4066..4197
5470
CTACAAAAAATAATGCTGACATAAATATCCTTGCTCACATGACTTTGAGGAACTGTTTC
TGCAGGAAATATTCCTTAAAGTTGACACACGATGACGGCTTACCTATTGGTCCGATTTTA
CGATTTTTAGGTGCCAGTGGGAGACGCTCTGTGCTTGCTATTTTGAATGATCCATCATTG
CACATTTAAATCAAGGTCCAAAGTTCACGACAAAAAGATGTGTAAATCAGATTTATTGCT
CTGTGTAAATTCGTCTTCCAGGCTGCGTCCACACTGCCACGAAAGAGGTGAGTTTGGGGA
AGTCGGCGCGGGCCGCCCGCGTTCTCCGAGAGCCCGGCGACCTGGGCGGGGGCCGGAGTG
AGGGCCGGCGGCTTCGGGCCGCGGGAGGCTACGCGGGAGGAGACCCGGGGCTGAGGCGCC
CGGAAGCCTCCGCAAGAGCCGCGGCGTCGGCAGCCGAGGGGAGCTGCATTAAGACTGCGG
CCCAGGGGTCCCCGGTGGCGCAGCGGTGTGGCGCCTGCCTGCAGGCCCGGGCGTGATCCT
GGAGTCCCGGGATCGAGGCCCGCATCGGGTTCCCTCCAGGGAGCCCGCTTCTCCCTCCGC
CCGGGTCTCCGCCTCTCTCTGTCTGTCTCGCATGAATAAAATCTTTAAAAACGATATGCA
AAACTCGCCGCTACATATTTAAAAAAAAAAAAAGACTGCGGCCCAGCTGCCGCCGCCCGT
CTCACCGTCCCTCCCGCCTCACCCTCCGGCGGCTTCCAACTCCCGCCAGGGTCGACAGCC
GCGACTCCTCCGTCCCCGGCCAGGGCAGGCGAGCCGCTCTCCCGCCGCCCAACCGAGCAG
CTGCAGCCCCGCGAGGCCGCCCCCCTCCACCTCTTGCCCCGCCCCCCTCCACCTCTTGCC
CCGCCCCTTCCGCTTGCGGCTTGCTTCCGGTGCCGCGCTCCCGGCTCTGCAGGGAAGAGC
TCTGCATTGTGGGAGCTCTTTCCTTTCTCCCTCCCGGCCATCTTGGCGGTTGCTGTCGGT
GAGTGGGCTCCGCGGGCCGAGGTCTGGGCAGCGCCGGGAGCCCGACGACCTGCCCTCTGG
CGCGCCTATCCCAAACTTTCCGCCCTGTCCTCTGTACGTTCTAGGTTGGGGCCGTCCCGC
ATCTAAGGCAGGAAGATGGTGGCCGCGAAGAAGACGGTGAGTGAGACGGGGCCGAGGCCG
GAAGCCGATTCACGTGGAGGGCCGAGTCTCGGCCCGGGCAGACGGCCTGAGCACACCGGG
CAGACAGCATGCACCCTGGCCTGAGGGGCCGGGAGGAGCCGAGGGGGCCTCAGTGACGTA
GGGCCCTGGACTAAGGAGGTGTATTAAAGGGTTCGACGCCCAGAAATCTGGATGCTGTTT
TGAGATGGTTAAAAACAAGACCTTCAGGTCCGTGTTAAATGTTTGCTTTGTAGAAAAAGT
CGCTGGAGTCGATCAACTCTAGGCTCCAACTGGTTATGAAAAGTGGAAAGTACGTGCTGG
GGTACAAGCAGACCCTGAAAATGATCAGACACGGCAAAGCGAAACTGGTCATCCTGGCCA
ACAACTGCCCGGCTCTGAGGTAATGGAGGGAACCTGGCTGACACGTGTGTCCCCACTGCA
TGTTCACCCAGGAGTGTGGATTTGAGCCATTTGGGTTGTACCCACTCGGTTTTATGTAAA
ATCAGTTTTAGAAGCGAACGCTTGCAGAAGAATTTATGGTTTCTTCTTCTATGTTTGGGG
CTGACACCCACCACCCACCCCCGTCTCCCCAATCGTGCTCTCATCCTGTAAGTTTATCTT
TGGGAGAAATGTGTGGCAGAGGGGTATGAACCACAGAACGTCAAAGTTTGAAGCAAGCAC
GGACACTTGTTTTTCCATGTGTTTTGAGTCCTGCATTTTTGGTCTTTAAAAGTGTTTCGT
TTTTCAAACTTGTCATAGAAAAGTTCGAGCTTGCTGTGGAGCTGCAGGTTCCAAGTGGGC
CAAGGTTTTGCTTGGCTTCACCGTTTTGAAATTGAACTTAGTATGGAAAGTAAGTTAAAG
ACACTTGGACTATGCAGAATATAAGCCATGTGAGCAGTTCCCTACAGTACATTAAATTTT
CTGTGGTGATGCATAACCTGCTCACAGGATTTTATATAGGGTGTCTGTACATCATTGGCT
TCCCTAGAATGCTGTCCTCTATCCCATCCCATGGTTTGGTCTTCAAGCTTACCTTCTATG
GCAGTGCTTCTCAAACATAAATGTACACACAATTACTGGTAATCTTGTTAAAAGCAGGTT
TTGATTTCATGGGTTCAGGATGGGACCTGACATTATGCTTTTTGTTTTTTTTTAAAGAGT
TTATTTATTCTTAAGAGGCAGAGACAGGCAGAGGGAGAAGCAGGCTCCCTGCAGAAAGCC
CAGTGTGGGACTCGATCCCAGGACCCCAGGATCACGACCTGAGCCAAAGGCAGACGCTCA
ACCACTGAGCCACCCAGGTGCCCCAACATGCATTTTTAATAAGCATGCACACTACTGCTG
GTCTGTGAATCCATACTTTGAGTAATGGCACCGTTCTGTTAGGAGTCTCTTCAAATTCGT
AAAACCCTTAATGTCCACCTGCTCAGTTGACACAGAAATGCTAACTTTGTGTAAGTAATA
CCCCTCCCCATCTAGGATTCAGAGCACCGGGAAGTAATAGAAATAGCTCATCCTTTAAAG
ATAACATGAGCTAGGATTCTAGAACCTCCACTTAACCATTCTTTGCCTGAGTGTCTCCAT
TAGTTTAAAAAAAATGGAATACATGATATTTAAGAGATTGTCATGATAATGTGAAGTATC
TGGTGAGTGGTAAATGCTAAGTAAATACTTATTTTGAGAAGAGTTATTCAGAACATACTT
GCTGATTGTCCCGTTTTTAAGGGACCAAGAGAAAAGATAGTTTGTATTGCCTAATGGATC
TGGTACTTTTTTAAAGAGTAATGACTGATTTAGTTACTGTTTGAAAGTTTCACCATTAAA
ACCAATGAGGAAAGTAGTAACATTTTATGTCAGTCACTTGGTATGATCTTTGTTTTTTGG
TTTCTGAAGGAAATCTGAAATAGAATACTACGCCATGTTGGCCAAAACTGGTGTCCATCA
CTATAGTGGCAATAATATTGAATTGGGCACAGCATGTGGGAAATACTACAGAGTATGCAC
ACTGGCTATCATTGATCCAGGTATGTTTTATACGTCAGAATAATTATTTTTTCATATATA
ATGTAATTACAGGTATTTGCTATAGCAATGTCTTCGGTTCCTAGGTTTAGATATTTAGAA
TTTGAATATAGCAAGGGATATCTTGTAGTTTTGTTTCACAGAGAATTGATAATGAATATC
AGTACATTATAATAGGTATTGTTATAAGTTAATTTTTTTATTTTGTAATTAATTTGAAAT
TAAATAATTATTTTTTTATTTTGAATTTTGTTTAAGCACTTAAATAATGTAGGACCGTGG
TAGGGGTGAAATTCTAAAGGCAAGGAGTAATCAGATAAAATAGAAGAAAGGAATCCAAGC
CAAGAAGTGGCTGCCTAAGAACAGATAGGTAAAATTAAATTGAGAAAAAGAAATGCCTAC
AAATAAAGATCATGTTATATTTTGAACTTAGGAGTTTTTATTTTATTTTTAAGACTGTTT
AGATTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTTAAAGATTTAT
TTACTCAGAGAGAGAGAAAGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCAGG
TAGCCCGATGTGGGACTCGATCCCAGGTCTTCAGGATCACACCCCAGGCTGCAGGAGGCG
CCAAACCGCTGCGCCACCGGGGCTGCCCTAGATTTTTATTTTATTTGAGAGAATGGGCAC
CAACAGGGTGAGGGGCAGATGGAGAAGCAGACTCCTGGCTGAACAGGGAGCCCAGTGGAG
AGTTCAGTTCTGGGTCTCCAAGATCATGACCTGAGCCGAAAGCAGATGCTTAACTGACAA
AGCCACTCAGGAGCCCTGAACTTATGAGTTTTTAGTTCTTAGGATACCGCGAATATTCTC
GCTGTTCTGATTTTGTAATAATCAGGGCAGGCTAAACATTCGCTATATTAAGACCATGCA
TGTGTCCCCAGACTTAGTTCTTTCCCTGGGTCTGGTTTTATCAATGCAGGTGATAAACCA
AGTCTGGTTTATATCATGTATCTTCTGTGGGAAATGCCTGTGACTTTAGGTATCTGATCA
TCCTTGAGAAATGACAGCAAAGCTAGTATTGCAACTTTTGGAGATAACCACTGCTAGTTT
GATGATTAACAGTTGTGACTAAATGAATTGTAAAACTATTGTGTTTTATTTTTTAGGTGA
TTCTGATATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAATCATGCAAAATTT
TTCTTTAATAAAACTGGCCAGAGCTTGTTTTAAAGACACTGTGTATTCATTTCTGTTTTT
TTCCATATATCTTTGTTTCTGTACACTTTCACAAGATAGGATTTGAGAGGATGAGGCAGT
TGAGGTAACAAGACTTTTGGATTAAGAGCCTATGTGTCCCAGTTTCCCTTTACTTTCATG
TATAGGGAGTGCAGAGTTCGTTTTCTCTGTTAGATTTTTAAAAGATTCCTGTCTTTTAAA
ATTGTTGATACCGTCGTCATTTCATATTTGAGTATGTTTGAGAGGCAGCAAAGAACAATA
CCCAGAATTTTTTTTTTAATGCCCAGAATTTAACCAGATATGCAATTTGTAATCCAGCTT
AAATCTACAAATTGAAGTAGCAGAGAGGATTAAATATGTTCTCCCCTCCCAGAATTGTTT
CTGTCTGAGAAAAGTTCTATTGAACTTTAATGAAGAGTTTTTCCTAAGGGTGTGTAGTGG
TTGAGGGAGAAGAACTGTAGTTCGAGCCCTTTAGAAGAATCCCAGATCTTCAATAAGTGC
TCAATCCATAGTTGCCCAAAGTTTGTTTTATTCCATTTTACTCCTAGAAGATAATTGTGA
AGTGTGTTTGGTGTTCAGATTTTTGGAGAACTACATACTGTATCTCCCAATTATGTATGA
TTGAACTTTTTCCCCACAACTGTTACTTCCTTTGGAACATTTTCAGGAGTTCTTTGGGGA
AAAGTACTGATTTAGGTATATCCTGATTTACAGAATCTAATGTTGGTAGAGTATACTTAG
TCTGTGTTGTGCTCTCAGGCTGCAACTGTGTCAGAAATACCCATGTCTTTTGGACTTGAT
CTTATCCAACCCTTATAAGCACTTTTGGGTAGTAGATGAATGATCAGAGAGGAGGTTGCC
CATCAGTACGCTATATGGAATGTCTGTGCAGTATTTACTGAACTTCAAGACTACTTTTGG
AACAAGCATGGGGTGTCAAATTCCCAATTCCATAGGTGAGAGAACGGGTTTCTTTCAAGC
TAACATTGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1124..1175, 1433..1578, 3069..3199, 4376..4470
1155..1175, 1433..1578, 3069..3199, 4376..4422
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved