Canis_familiaris Locus NOL5A
snOPY snoRNA Orthological Gene Database
Canis_familiaris NOL5A
Canis_familiaris
NOL5A
24
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
1993..2060, 2832..2962, 3830..3915, 4353..4423, 4691..4761
7103
ACTAAAGTAAAGGTAATTTCAAATTAGTCGCCAGAATGCCCAAACCCCGCCCTCAAGGA
CCTGGAAGCACCTGAGAGCGCTTGGAGCTACTGCGGGTTCCGCGGGCGGGCGGGGCGAGC
AACACGTGGCCCTTCCCAAGGGACCGGTCCTGCTTCCGTGGGGGACCTAGAAACCGACCT
GGGAGCAGGTGAGATGGTCACCCTTTTCTATTTTATCGCCTGTAATAAGCATTTTTGAAA
TAATAAACAAAATGCACCCGAAAGGCAAGAGGCGGGACACGAGGAGCCGTGGGTCTCCTT
TCACCGGGTCTGCGCACACGCGCCACAGGCCCCGCTTCCGCCCGCGGGAATAGCGTGGCC
CCCGAGCGGGAAGCGGAGACGGCGGGGCCCCGGGGTGGGGGGGAAGGTCCCGGACCCCCG
GACCCCCGGCCACCGGCGCCGCGCAAGGGGGAACGGCCTCCCGCCCGGCTCCTCCTAAGG
GAGCTCCGCCACCCGGATCCCCGCGAGGCGGACCCGAGGGGCCGGGGCGTTCTCCGGAGA
AGCGCCTTCCCGACCCGCTTTGCGGCCTCGCGGGGCCGGGCCCAGGCCGCGCGTCCCCGG
CAACCGCGCGGAGCGGCGCCGCGGCAGAAGGCGGAAGACGCCCGCGCGCCCGCGCTGGCC
CTCCCGCCCTCCGGGCGACACCACCGCCGCGGACCCCTCCGAAGTCCCGCAAAGGTATCG
TCCCCGGCCTCTGATTGGCCGGCGGCTCGGGGGCGTGGCCTCCGGAGCCCGGGTCCGCGC
GCCAGACCCCGCTCGCCGCATTGCGAGCCGGGCCGGGAGCGGGCGCCATGGTGAGGAGTG
GTTGTGGGCGCGGGGGAGACGAAGGCCGAGGTTGGGGCCGAGTCGGGGGCGGGGCCGGGG
CCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCGGGGCCTGCGCTGGGAGCCGGGGCGGGC
GAACGCGGAGACCGTGCTGACGCTCGCGCCCGGCTCCGTTCCAGGTTCTCCTGCACGTGC
TGTTCGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTCAAGGAGGTGGAGGAGATCAGCC
TGCTGCTGCCGCAGGTGGGTGGAAGCGGTGGGCTCGCCGCCGCGCCGCAGCCCCCCGGGC
CGCCGGGCCCCAGCATGCACCGCGCGCTCCCACGTGGCCGGCCGCGCTTTGGGGGGTGCG
CTGGGCCGGAAAGCCCGGGAGCCGGGGGTCCTCCGCTGCATCCGTGCCTACAGTCGCGTT
GGGAGCATGTAGAAGCCAGCACCCCGGGATTTAGGGCCTGTAATCGGCTCCTTTACGGAG
AACCGCTGCTTTACTGCGCCCTAGAGGCAAGAGCGAGGGAGGAAAGCCATTCACGCTCTC
TTCTCCCCGAAGGTGGAGGAGTGCGTGCTCAACTTGGGCAAGTTCCACAACATCGTTCGC
CTCGTGGCCTTTTGTCCCTTCGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTG
TCCGAAGGTGAGTCGACCACCACCAGGTAGGTATTTGAGGGAGATGACCGCAGGGTTAGT
AGCTGCTGCTCTTATTCTCATAGGGAGTTCATGATCCCGTTTTCCTTTCCTCAGCTGATT
TCTTACAAATCTGATACGTGTTGGGCAGTATTTGATGTGTACAGGATGTAGTTTAAAACA
GAACCCAAGGTCTGGAGAATATGGTATGCTAAAAGTTTAAAGTGTATATTCCAGGATAGA
GGCTTTCTTTGTGGTCCTGACAGCGATAAATGATTAAGTGAAATCTGGTAGGTGTGCTTT
AATGCTAAAGGTGGTTCTTTGGTTATTATTGAAGTGATTGGAAAAGGCAAGAAAAATAAG
TTCAGTTCCAAAAGGCGAATCAAATACTAAATACTTAACCTCTATAGTTTCTCCGGGTTT
AAGGTTTCAATTCTGTATTTCACACTCATGCTATCAGACCTGAGTCCTATTCCTCCCATA
GTTGATGCAGGCTTTGCAGTGATGACTTGAGTCTGTCAATCCCCTGAGTGCAATCACTGA
TGTCTCCATGTCTCTGAGCAAAGCCTAAAGCAAAGAAGGAACTCAGCATGCTCTGTGGGA
CAAATGTAGGATCAGTCTGTCATTTAATTAGCAGTTAAGGGGACAGGATCCCTTTTATGA
TTTCAGCATGTTAGTGGGAGCTCTATTCTTTGCCTTGAGGTGTCGTTCATGAGGACCTCC
GCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTCCTGGGGGTTGGAG
ACCCCAAGATCGGTGCTGCTATACAAGAAGAGTTAGGGTACAACTGCCAGACTGGAGGCG
TGATAGCTGAGATCCTGCGAGGTGGGACCACCTATTAACATTCACAACATTCTTGACATC
TCTGAGGGGGGATCTAGTCACTTAACCAGGGTGCATAAGGTTGCTTCTAGGAAGCCCTTC
TGCTTGGCTTGGTGCCCATGGGCGCCGTAACTGGCTTAGAGCCTTCCCTTGCTCACTGAC
TTGTCCTCTTCCAGGGGTTCGTCTGCACTTCCACAACCTGGTGAAAGGTCTGACAGATCT
GTCTGCTTGTAAAGCCCAGTTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTT
TAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATCAGCCTCCTGGACCAGCTGGA
TAAGGACATTAATACTTTTTCCATGCGTGTCAGGTAAAGTGCCCAAGTGACCCTTGAAAA
TAGGGTCTTTGGCCTGTGGTGTAGCTAATTTCACATGCTGAAATCAGGACCACTTCCTGT
GGGGTGGGGCTGAGCCTCCCAGTGCTTACCACAGGCTGTGTTCTTACACTGGCTGTACAG
AAAGAGGAGGTAGAGTAAATCCACCCATATACACCCCAGCCTAGGCTCTTTGCCTGGTCT
GTATTGTGAATGGGAGGACACGGAGTTGAGGTTTTGAATTGTACTTGATTCCTTTTCTCT
GGGTAAAGAATAGATAGAGGGCTGAGGTTGTAGCTTTGAGATCTAGTCGCTGAGCAAGGA
GTGATTGTGGCTCTCTGCAGGGAGTGGTATGGGTATCACTTTCCTGAGCTGGTGAAGATC
ATCAACGATAATGCTACATACTGCCGCCTTGCTCAGTTCATTGGGAACCGAAGGGAGCTG
AATGAGGAGAAGCTTGAGAAGCTGGAAGAGCTGACAATGGATGGGGCCAAGGCTAAGGCT
ATTCTGGATGCCTCGCGATCCTCCATGGGTCAGTATAGCCTGGTGACCAAAATAAATTTG
GGGCTGTGGATATCTGGTCCTGCATTCACACTAGGTGTCCCTTAGGCATGGACATATCGG
CCATCGACCTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTGTCAGAGTACC
GCCAGAGCCTGCATACTTACCTGCGGTCCAAGATGAGCCAAGTAGCCCCCAGCCTCTCAG
CCCTAATTGGGGAAGCGGTGCGTTGTGGGGAACATAAAATGGGGTTAAGGAGTGTTAACA
GTGTAGGTCCACACTGCTGTATTTCTTGACCCATGTTCTCTTCCCTGGTCGCATTTAATG
GGCTGAAGCAGAATTGTGCAGTTGAGATAGACAATTCCAGCCTCTAATTCCTTGAATCCT
TCTCCAGGTAGGTGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACTTGGCCAAGTA
TCCAGCGTCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGG
GCACCTGCCCACACTCAGGTGCCACTTCCGGTGCCCACTGCTTGTTTGGGGATCACAGTG
ATGGCTGACCAGGGCTCCCTGACCTATACAGACCTCTGCTATGGGGGTGATGGCCAGCCC
TGGTGTCTGAGTGATTCCTAGGGCCCAGCAAAAGGGACCAGATTTCCAGGTCAGCGACAT
TGGATGCCTTCCCTCTGCCTCCGGGAGCTGTGGGTTGGCATGAGGTGGGGTAGAGACCCA
GTCTAGCCTGAGGCTCACTGGATAGAGACTGGGGATACAGGGGAGGGGAGGAGCTACCTT
GGCTAGTAGAGTTGAAATTTCTGATCTTAAAACTCCCCACTAAATATTCTTCTCCCAGAG
CCCTGAAGACCAGGGGTAACACTCCAAAATATGGACTCATTTTCCACTCCACCTTCATTG
GCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTA
TTGCCTCACGAATTGATTGCTTCTCTGGTATGGGTGGAGGGGGTTGGAGGAGAAGGGGCT
GGGAGGGAGGGAAGGCTGACTACCTAGCAGCTTCTACAATGATGGCAGTATTTTTCGTCA
ACAGCAGTTCACTTAGTGAGTGTTGAGACTTTGGGTCTGAGTGAAGCTGAGGGTAGAGGG
AAGACAGGGTGGGAAATAGCTGGTCCTTTAGGGGCTGACAGGTTTTGTTTACCCACACAC
ACACGCACACATCCAGAGGTACCCACAAGTGTATTTGGGGAGAAGCTTCGAGAGCAAGTT
GAGGAGCGGCTATCCTTCTATGAGACAGGAGAGATTCCACGAAAGAATCTGGATGTCATG
AAGGAGGCAATGGTTCAGGTCAGTTTGGACTTGCTGGGGTGAGAGAGGGGATGGGGACCA
AAGCTGGCTGTTGGAGGTGATGAACAGGCTTAGCCTGACTTTGTAGAGTGGAGGCAAAAA
ACTGATTTAATGAGCCTGATCCAATGAAGCCAGAAGGGAGGTCTGGAGATACTGCAGTCT
TTGGGGCCTTTTCATTACCTTTCTTTGGCCAGGCAGAAGAAGCGGCTGCTGAGATGGCTA
GAAAGTTGGAGAAGCAGGAGAAGAAACGCTTGAAGAAGGAGAAGAAACGGCTAGCCGCCC
TTGCCCTTGCATCTTCAGAAAACAGTAGTACCCCAGAGGAGTATGAGGTCAGTAGGCAGG
ACAGCCCTCAGCCCAGGGTGAAGGCCCTGGATGTAGGGTTCTCCACAGCAGAACAGAGGA
TATGCTACTTCAAACCATGGTCTTGAGTCCAGACTTGGACTGAAATAAGGACCTGAAACA
TCTCAACTACCTCTTGATTCTATAGGAAGGAGATAGGTGCTGAGAGAACTGGCTCAGGAG
CCCAGAGAGCTGGTTGTAGCACACCCGGTCCCTGGGCAAGTGTTCTGTCCTCGGCTGCCT
CCCAGGAGTCCTCAACCGGGGGTAGTATAAATTCCTGCTCTGCGTGTCCTCGGCCGTATG
TCCGGAGGTGGTAGCATTTCATAGTTGGGCTTGGGGCAGGGAGGTATCCATAATGCTACA
TCAGGATCCACCCTGGGATTTTCTTGAGGTACCCAGTTTGTGAAGTAGTTTTTCAGTGTC
CCCTTTGCAACCTGGCATGATGGTTTGTGGGTTTTTCTATAAGCTGATTCATGGGTTTAG
AGAACACATTTTTCCTTTCTAAGTGGGAGTCATCTTTGGGGTGGATGTCTAGTGTCCATT
AAAAACCATCCCAGAAACACTGGGCAGTTTTCACATCATTCACACCAGTCTTTGCCCTAG
CTACTTTTAATATGTGTGTGTGTGTCCATATAATGGATGATCGTTTCATGCCCATTTCTC
TTTAGGAGACCCAAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGACTC
CACAGGAGAATGGAATGGAAGACCCATCTGTCTCCATCTCCAAACCCAAGAAAAAGAGAT
CTTTTTCCAAGGAGGAGCTGGTTAGTAGTGATGTTGAAGAGACAGCTGGCAATGTAAGTC
TTCCCAAGAGGAAGAAATCTTTTCCCAAAGAGGAACCAGTTAGCGATGCTGAAGAGGCAG
TAAACAGGAGCGTCCCCAAGAAAAAGAGGAAATTCTCTTCTAAGGAGGAGCCACTTAGCA
GTGGACCTGAAGAGGCTGCTGGCAACAAGAGCGGCAGCTCCAAGAAAAAGAAAAAGCTCC
AGAAGCTATCCCAGGAAGATTAGAATGGACATTTTACCAGGTGGGGCAAACCCACATGAT
TCCAAACCCACCCTTATATCCCAATAAAAACAAATTCACAGGAGTCGATGTGTTTTGTTT
TTTTTTTTAGGAGTCCATGTTTTATTGAACACCTTACATGGGTATGGGTGGACCTATGGG
TGAGGCAGAGCACCAATGACCGCCTCAGTGAAGTCTTGGCAGGTGGCATAGCCACCCATG
TCAGAAGTTCGAACCTGTAGGGGAGAATTGTCATCATCCCTGTGGCCTAGGCCCCATCCC
TAACCTACCCCCCACCCACCCCCTTCCAATAACACAGTTCCCTAAGGAAGCCAGCCCCAG
GACAACCTAGGCTCTGCCCAGATTATGGTCTAAAGATTTATTTAAGAACTCTTCTCTGGT
CCACTGTACTGAAGGGAGGTGTAGGTAGTATGGTCCTTGTGAGGTTGGAGGGAATAAAGG
GGTCTAGCCCCCATGGGGGTGCAGGTGGCCGATGACAGACTTGATGAAGTCGGTTGTGGT
GCTGTAGCCGCCCATGTCTCGAGTCCGCACCTACAGCCACCACCGGCAACAGCCGTGGGG
AAGAAGAGAAGAGAGCCCATGAAGGGGGGATAGGGCAATGTGATGGAAATGGAATCCAAG
AAAGGATGGCAAGGCCAGGAAGAAGATGCAATGCAGCAGAGTTGCAAGGAGGTGGCCAGG
TTTGGAAGAGCATGGACCCATCCACTCCCAGCTGAGGGCCAGAGCCACTCTCAGAGCTAT
GCTGCAGCCTGGGCAGGATGGGAGGGAGGCTGAGCATGAAGTGAGATGGGAAATGCACAT
CAGACAGGATGAGGATGCCTTAAAGGAAATCAGACCAGGTGGGAGGAAAGGAAGCCAGAG
GATGGGCTTCCAAGTGTGGAGAAGGGGACACCTGTGCCTCATCCTGCCTGCTTGCTATCT
CCCTCTGCTCCTCCATCCCCCATGCTCTCTCCCCAGGCAGAGAGCTGCAAGCGCTGCATT
AAGATGGCCATAAAAGAGCCAATGGATGGAGCAGGAAAGGGAATAGCAGACGGTAACCAA
GAGGCAAAGGAGACCCAGAGGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1392..1506, 2199..2360, 2534..2732, 3080..3267, 3345..3496, 3667..3767, 4138..4286, 4516..4637, 4832..4966, 5645..6103
1001..1093, 1392..1506, 2199..2360, 2534..2732, 3080..3267, 3345..3496, 3667..3767, 4138..4286, 4516..4637, 4832..4966, 5645..6019
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved