Canis_familiaris Locus NOL12
snOPY snoRNA Orthological Gene Database
Canis_familiaris NOL12
Canis_familiaris
NOL12
10
SNORA21
3703..3837
6170
AGAGAGACAGAGACACAGGCAGAGGGAGAAGCAGGCTCCGCACTGGGAGCCGGATGCAG
GACTTGATCCCAGGACCCCAGGATCACGCCCTGAGCTAAAGGCAGATGCTCAACCGCAGA
GCCACCCAGGCGTCCCGAGAATGTGTTATTATTACACCCCAATGCCACACCTGGGGAAAC
TGAGGCAGACAGGGGAGATGACTTGTGTAGCAAGCACGTGTGTGGCAGGTATTACTTACA
TGAAGTGTTACGTAACTCACGTTTCCTCCTCCTCCTCATGGTTCTCAAAGTATGGTCCGT
GGACCAGCAGTATCAGCACACGCGCGCGCGCACACACACACACACACACCCCCAGAACGA
GTCAGAATCGCAGATTATGGGGCTCACTCCAGACCCGCTGAATCAGAAACTCTAGGGCGA
GGCCAGGAGATCTGGGTTTCCGCAAGCCGTGCAGGGGATTCCGAAGAACGTCAAAGTTTG
AAAACCACTTCCAGGGGATCCCTGGGTGGCTCGGTGGTTCGGCGCCTGCCTTTGGCCCAG
GGCGTGGTCCCGGGGTCCCGGGGTCCTGGGATCGAGCCCCACGTCGGGCTCCCTGCATGG
AGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCATGAATAAATAAATAA
AATCTTAAAAAAAAAAAAACACTGCTTCGCAATCATAAAGTCACTATAATCATTCCCATT
TTACAAATGGGTAACTGCGGCAAAGCGAGGGCAGTTGGTCCGGAACCACAGCCGTAACGT
CCTGAGCTCCGGGACTCGCTTTCACCGCCGCTAGCCTAGGAATGGGCCGGGGTTAGGAAT
CATGGGGCTGGGGAGGCGGGCTCCGCGGCCCCTTTAAAAGGCGGGGCCTGAGGAGCGGAA
CTGCGCAGCGGGAGTGCGAGGCGCCCCCGGGAACCTAAAAACCGCTACACCCGGAAGTGT
CTTAGGCGTGCGGGAGCCGCGCCGCCGGAGGCCGCGCCGCCATGGGCCGCAACAAGAAGA
AGAAGCGAGATGGCGACGACCGGCGGCCGCGGCTCGTCCTCAGCTTCGACGAAGAGAAGC
GGCGGTGAGTGCGGAGGCTGGAGCGGATCTGCCTCGGGCTGCCGTCCGGGGCCGGGGCCA
GAACCCGGGCCGAGCGGCTGCGCTCACGCAGAGGTCCCTTCCGGTCCCGCCCTCTCGGCG
CGGCCCGCGGCTCCCCCCGACGCCCCCCGCGGGATGGACGCGCCCGCAGCCCCCCCCGGC
CTGGGGGGTGGAATCGCCCGCCCCGCCCCCCTTCCCCGGCTCTGCGCCCCGAGTCCCGCA
GTGCGCGCGGCGGGGGGTGGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGTGGGGGTGGGCGGCGGTGGCTAGGGGACCCCCAGGCCTCTGCGTCAAGTCCGTCGGA
GGTTCCCCGCCCCGCCCAGAGCGCCACTTTGCCGTGTGGTAGTGGGTCGGCGAAAAGCCT
AGTGCTGCTCCCCGGACCCCCCAACATTTGGGAATGGTGCGGCCAGCTCCCGAGAGAAGG
AGCCAAGATCACATAGAGGAGGGGAGGGCAGGTGCCGTCCAGGGGCCCTGCAGATGGGTC
CAGGGGCAGGTGTCCTGGGGAAATGGGGTGAACTCCAGTGGAAAGTGTGTGGGTGTCTCC
GTGAGGGTGGCCTGAAAAGCTCTGCTGGAAGTGGCTTAATTCACTAGGTCATGGGATTTG
GCAATGTAGGAGGGGCCCCCACCTGTCCTAGGCTCGTAGGCCCACCTGCCTGGCCCTGTT
GAAGCTGAGCCCTGGAGGGATGGGGGTGGAAGGAGCCTCTCGCTCTTCTTCCTGACCTTA
CACTCCCTATGACCTTTGGCAAGTAGTCTAGCTTCTCTCTGCCTCAGTGTCCCTGTCTGT
AAAATGGGCATTGGTACCGACCACACAAGCTGTTGTGGGGAATAGGTGAGTTAACACGTG
TGCATTTTTAGAGTGGGTACAGTATTAGTGGTTTTTCTCTTCCTGGGGTGAACCTTTCTT
TCCTGTGTGTCCTCCTGACTCTCCCTCGACTCTTTCCTGTAGGGAGTACCTGACTGGCTT
CCATAAGCGCAAGGTGGAACGGAAGAAGGCAGCCATTGAGGAGATCAAGCATCGGCTCAA
GTTGGAGCAGAAGAAGCTCCGGGAGGAGGTACAGAGGGGAAGGCTGGGGGGGAAGGGGGC
TAGGGAGAGAGAGAAAGTGTGTGTGTGCATGTGTGTATCTATATCTATATATCTATATCT
GATTCCCAAGGGATTCACATCCTTGGGTGACCTTAACAGGGGCATCTGCAGAAATGAGGG
GAGGTGTGGGCAGGCCCGGGGAGCAGTGTGTACATGCTGCATGTGGGCTCGGGTCTGGGG
AAGGTGTAGAATGGAATCTCCTGGTGTTTCACTATGAGCTCCTGCCTGGGGTTGGCTGGA
GAGGCCATCCTCACTGTGTTTCCTTCCCTTTTGGTTTCAGCGCCATCAGGAATACTTGAA
GATGCTGGCAGAGAGAGAGGAGGCTCTGGGTAAGTCACATCTTTGCCCTGAGCTGAAGAA
AAGCCAACAGACCTAGACTTATTTATCCCTTGGTGGATGGAAGGGGAGGGGTGTGGGGGC
TGCACAGAAGCTAATTTCCTAGTTCCAGGGGTCTTGGTGGTGACGTGGGCCATCGGCCAG
GGCTGGTGTTCAGGACCCTCTATAAATGTGGGTGGATCAGAGACAGGAAAGACCAACCTC
TTGGTAAAGTGATCCTGAGCAGAAAGCCCAGTTTCTGAAGCCTGGAGGGACTGGGGGTAG
AGGGGAATGGGTAGTAGCAGCTGCTGGGGTCACACCAGGTCTGTCCTAAATGAGAACCAG
ATGGTCTGAAGTCTCCCCAGAGTATCGGAAGGAGTTGAATCACTTACATTTGTCTGCAGA
CCAGGCTCTGGAGCTGGTGACTTCCTGGACACTCTCCCAGAGTAGAGGGGGCCATTGTAC
TCCAGGGCTGGGCAGGGGGTTAGAGTCTGGTTACTTGTGCTCTGAGGCTGAGACCTGGTT
CTGTGCCCACCTTGCACAGAGGAGGCAGATGAACTGGAGAGGCTGGTGACAGCAAAGACA
GAGTCAGTGCAGTATGACCACCCCAATCACACAGTCACCGTGACCACCATCAGTGACCTG
GACCTCTCAGGTGCCCGGCTGCTTGGACTGCCTCCACCTGAGGTGAGTGTAACTTCCAGC
CCTAGGGAAGATGGGCCCCAGTGCAGCCCTAGGTGCATACTGGCTTGTTGGGGATGCTGA
GTGCTGGTCCCTGTTGGGCAGATTCCAGTGCGAGGGGCTCTTTCCCTCCTGGGCATTCTT
CAGGGCCTGCACAAAATCCGTGGGGCTTGGAGAAGCCGGTTCTGTGACTCAGTGACTGTG
GGAACATGGGCAAGTGTCTGCCTTGCCAACTTTCCTTTTGCCAATAAGTTGAGGGAGAGG
GAGGTAATTGATGATAGCACCTGTTTCTTGGGATTGCTGTGAGTATAAAAGCGGTTAATC
CAAGTGACGCACCTCAGATACCAGTTTGTGGTGATCACACCACTGCATGGTAGCAGCAAC
GACACAGCCCATTCATGTGCACTGACCGTTTTCAAGCTGTGAGTGGGGAGGTACTCACAG
ATTGTAACCAGTATTTTAAAAAGATTAAAAAAAAAAAAAGGATCCCCTTTTAAAAGCACT
CAGTGGGCCCTGACTCATGACCCACTGAGCCGTCAAGAAAGGGCAGAGGAAAAACACTGC
TTTTGGATGAAGCAGCAGCATGTTGTGTTGTTTTGCTTCAATCGGTGATATGACAGGGTG
TTCCACCTTGGTGGGGTACAAGGGGGGAGAGAGGTTCGAGGTGACGGGGGCAATGTCACA
TGGACAGAGCTGCCTAATAAACTCTGAAAAATTAAATAAAAATATTAAAAACAAAAAGTT
AAGGAAAGAAATAGAATGTCTTTGAAAATATCAAAAATACCAAAAAGGCTCACAGGTAAG
TACCATTTCACAAAATGTTTCAAAGCTGTGTTTGTCTGGGTTGGATGCGCTTAAATGCAT
AATTTAAATATGCCTGTACATACAGCGTCACAAGGTGAAGCACATTTCCTGTCACGGGTG
AAAGCGTCCTTAAGCCCTGAGCCACTGCTTTATCATGTCCTTCCTGACCTCATACTCCTT
TCTCTTTTGTGCTTATTCTTCTGTAAATCCTCCACGGCCTCAGCTTGCAGTGGACGTGCA
GACACTCACAACTGAAAGAAGATGGGGACAAGGCTTTGAGACACAGCTTTTCCCTGTGTG
ATTCCCGCTTCGAAGTTGTACCCAGCTTGTCCCCCGGTGGCCTTCTCCGAGCCCTGAGCC
AATCCTCAAGGCAGCAGGCCACACCCCCACTTGACAGAGCCATGACTGCTGGTGTCAGGC
CTCCCAATCTACCACACTGTGTGACAGTCCTTGTCCTGTGTTTCTTTAGCAAGGGGCTGG
ACACAGGTCCGAGGAAGAGGCGTCCTCCATGGAGAAGCTGACCAGAGCCTTACCCAGGAA
GTCCAGAGATCCCCTCCTGTCCCAGCGGTGAGCCCTGGCGTGTCCCTCTCTCTGGCACTT
CTCCCTCCCGGCTGACTGTGGTGATGAGCCCCGTGGAGCCACCTCTCACTGGCTGGTGGC
ATGGAGCAGGTGTGGGGCCTGGTGCAGTGACTCTGCCTACCAAGTGTCCCTCCTCACTGT
CCTTACTCCCTTTTCCTGAGAATGGCCAGCCCTGGGTGCCCAGAGTACCTGGGGTCAGGG
CTTTTTTATGAGCTGAGGAACTGGCAGGCCCTCTAGGGTCAGAGCAAGCTGTCTTTGGCA
TGGATTTGGTACTCCCTAGCATTCGAGGCCTGTCCTGACTTCCTCCGGGAGCCAGGCACT
CACCCCCAAACCCAATCTTCCACTCATGTTCTGCTTTCCAGAGTAAATGAAGCCCCGGCC
TGACCAGCCTTCCATCCCCCTACAGGATCTCTGCTCTCACAGCATCACTGCACGCACATA
GTCGCAAGAAGACCAAGAGGAAACATCCCCGACGGGCCCAAGACTCCACCAAGAAGCCCC
CGAGTGCCACTCGTACGAGCAAGACCCAGCGCCGCCGGCTGACAGGCAAAGCCCGGCACA
GTGGAGAGTGAGCCCTGAGAACCAGCCATGCCCCAGCCTGGGCCCTAAGGTCCTGTCCTG
TCTCAGCCGGGCTGTCCCCATAACCCAGTACCGAGGTGGTGACTCTATGGCCCAGGATTG
GGATGCTAGCACCTCTCTGGTCCAGAGCTTGGGCTCTGGAAGGGGCAGACAGGTGAGAGC
TGGCTCCCCCCAGGAGGAGCCTTTAGAGCCAAATCTGGGGCATCTACCTAAATGTCTGCC
CCACCGAGCCATCATCAGATTTGTGAAACTGAGTGGTCTGTTTGTCCCTGACCCTGCTGC
CATGTGCCAAGGACAGGCTTCTGAGACAGTAGAAACTATTAGGGAAATGGGTCCATCCTC
ACTCTCCAGCAGTGGGTATGAAAGTGTTAGGTCTGGGCCCCCTTTCCCAGGTTACAGATC
AACATGACCTGTTGGGTACACTGGTAGGAACCAGAGTCATCTCACTACTCAAGAGCAGGC
TGGGATCCCTGGGTGGCGCAGCGGTTTAGCGCCTGCCTTTGGCCCAGGGCGTGATCCTGG
AGGCGCGGAATCGAATTCCACGTTGGGCTCCTGGTGCATGGAGCCTGCTTCTCCCTCTGC
CTAGGTCTCTGCCTCTCCCTCTCTCTCTCTCTCTCTCTCTCTCTGTGTGACTATCATAAA
AAAAAAAAAAAAAAAAAGAGCAGACTGCTGGGGCAGGTGGGTGAGCAGTGCCAGGCTCTG
CTCTTTACTGGCTGAGACTTTGGGTCTGTCCCTTCTTGGCCTCATTGGTCTTCTCAGCTG
AAATTGAAGTGGTGGAAGCAGATGAGTTCCAGAGCATTCCCTACCCCCCGAACTTGGGCC
TCTTCCCTAGGCTTCTAGTAGCTCCTGGAAAGAGACTAAAAAAGGAGTGATCAACCCTTT
TTAAAGAAAATGTAGGGAGATCCCTGGGTGGCTCAGTGGTTTAGTGCCACCTTCGGCCCA
GGGCGTGATCCCGGAGACCCAGGATCAAGTCCCGCGTTGGGCTCCCTGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1083, 2082..2187, 2500..2548, 3079..3221, 4489..4586, 5005..5170
1001..1083, 2082..2187, 2500..2548, 3079..3221, 4489..4586, 5005..5167
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved