Canis_familiaris Locus Q0QEN2_CANFA
snOPY snoRNA Orthological Gene Database
Canis_familiaris Q0QEN2_CANFA
Canis_familiaris
Q0QEN2_CANFA
10
SNORD59, SNORD59
1841..1916, 3421..3491
8563
tttctcttttttccttatttccaaccttcctgacctgcagttttaaaaaaagaacatag
tttcacgcaaacatgtgcttggaatagtctactttaccctggaatttctacttggtttca
caagtatattcatctcctccactttaagacaattccattgcatctctaggtggcccaaat
tcatcccttccttcttcctgtacccattttaccctgcactagtcgtttctgcatcgtttt
ctgtttaaaaggttggtactggggcacctggggcactggtggctcagcccatagaccatc
tgactcctgatctcagggtggtgagttcaagccccacatagggtgtggagcctatttaaa
aaataaaaataaaggcaggtcctaagtcttaattttacctttatctcttcaatttctggc
acacacacacacatctgttaaatgaccgggttagactagtttctttcattgtacagtact
aagtgtccggattcctgacctcctgaactacttggaagcttccaattccactgctgcaaa
agaagaaccgtgctttgagtctagagaaggctcctgagttccccaaggtcaccgtcaggg
gtgcgtcccgccccgcagaccgtcgcctagctcaaggtccctgctaacgtgagagcccaa
ggacagccaaagacagcccgcgtgcttcacgacaggaactcggccccggtcagaacgtag
ttccgccaagaacgctctctaactggcatctttgttatccaattatatctcgaggttccg
agggtggacctaacctgatattgcccaatgaaaacaaggaattcagattggcaccgattt
tgaccaatggttgaaaacatcagagattattaacctataggagcagcactgagagtgatg
ttcagcaaattcatccaatggccgtgcttactgcagagtgggccccgccccaacggggga
gtcggctgcccgcaccgctgcggcgctcagtctccacccggGCTCCGCCATGTTGGGCTT
TGTGGGTCGAGTGGCTGCTACCTCGGCCTCCGGGGCCTTACGGGGACTCGGCCCCTCGCC
GCTACCCCAAGTCAAGGTCTTGCTGCGGGCCAGCCCGGCAGCGCTCCAGTCCGgtgagtg
ccttcctctgggagccgggttcgcttctgccgccccatgaccttgagccgcaggccgctt
gtcactcgggcctgaggcatttctggtgaccgaaggacgtccgggccggcgctctgccct
ctaaccgcgggcgaacaagaataggtcgcctatgggagccttcttcgatataattcgcct
cattttgggaaagggctctctgtgacgcgaagtgtgggcaggtgccttgactttcccttg
gacgggggcccggaggccgcgaataatggagttttgtgcatgggaagattgtgcaggcgc
cgtcttggttcctgcgcggccctccctccggacttgtcttaattgaaagcaagaggaggc
cggtcttgggccgaatttgccagttcatgtgaccattaactgccctcaccccaatttctt
ccaacttttttttttttttttttgtctgttagCCAGAGACTATGCCACCCAAACATCTCC
TTCGCCGAAGGCAGGCGCTGCCACCGGGCGCATCGTGGCGGTCATTGGTGCAGTGGTGGA
TGTCCAGTTTGATGAAGGACTACCACCCATCCTAAATGCCCTGGAAGTGCAAGGCAGGGA
GACCAGGCTGGTTTTGGAGGTGGCCCAGCATTTGGgtaagtagaatttcttaggaattgt
aaagaacttgttgagtcccaagtaccccccaaatcagtcctccttcaatgacgattatat
caaaatgactttcgttcttctgagtttgctgaagctacatttcaggtactgagaaggagt
cttggttgctttaggtctttcatgccagctgaacattaaataccaagcctgcttgtcctt
ctgtataaccttgcaatatcttcaactaacagGTGAAAGCACAGTGAGGACTATTGCCAT
GGATGGCACGGAAGGCTTGGTTAGAGGCCAGAAAGTCCTGGATTCTGGTGCACCAATCAA
AATTCCTGTTGGTCCTGAGACCTTGGGCAGAATCATGAACGTCATTGGAGAACCTATTGA
TGAGAGAGGTCCCATCAAAACCAAACAgtaagtatccctcttgctgcatttacatgcaaa
ggaactacttttttttttttttttaagtaagctctacaccagaattggggcttgaattca
gaagtcacctgctctactgactgagccgccctggcacccctctgtagttttgtatatgaa
ggcaacaccttgtagtgtagcaaaatgttcctgcagagactgcttaaaatgctgatatat
tgtttgtttgtttttaaagattatatttattcatgagaaacacagagagagaggcagaga
cctaggcagagggagaagcagactcctcacagggagcctgatgtgggactggatcccagg
gccccgggatcacgccctgagccaaaggcagatgctcaaccactgagccacccaggcgtc
cctgatgtattgttatcaaaaccgtagatatagtttcttaagaaaattaaggatgcaaaa
gttctgattgtaaaaaacaaaacaaaaaaaccctgctgcttaggactcaagttgattatg
tgagttttaattccaatggctgggatgcctggatggctcagcggttgagcggttgagtgt
ctgccttcagcctgggtagtgattcctggatcctgggatcgagtcctgcatcgggctccc
cacagggaacctgcttctccctctgcctgtgtctccacctctccatgtctttcctgaatg
aataaataaaatcttttaaaaaatcataataataccaatggctgaggttgtggggtttcc
agaattggtgggtctttgtatttcctattgacgcatgaagaagtgctgttaggttagggc
ttagcaaaaggaaaatctttttgactgttaaagttgttagagattgcgattatggtttcc
tgagataatggaaatggaatcccctttattgcagaatgttaggcgaggtgccagatgcca
gcttgtgtggagtgttgtataagagatgagaattgagagaaaactttcaacaagatgaat
aaaaagacactgatcctctctacctacctctacagATTTGCAGCTATTCATGCTGAAGCC
CCTGAGTTTGTGGAAATGAGTGTTGAGCAGGAAATTCTGGTAACTGGTATCAAGGTTGTG
GATCTGCTGGCTCCCTATGCCAAGGGTGGCAAAATTGgtaagttatttatagtacatatt
ttccaaacctaatgtgggaagaaaaatcctgcagtgtaataagtaggtactaagatctat
ccctcactgatgagtagcttctgactttcgttcttctgagtttgctgaagccagatgcca
ttcctgagaagggaaaagatagaaaactagtataatttttttttctaagtttgcttattt
gggaacacacaacgcttaaatattgcttcttttcaacctcttccagGGCTGTTTGGTGGT
GCTGGAGTTGGCAAGACAGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCAT
GGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAAAGGACCCGTGAAGGCAATGACTTATAC
CATGAAATGATTGAGTCTGGTGTTATCAACTTAAAAGATGCTACCTCCAAGgtaagtagt
gacctggtttatgtccacgtagttgtagtgccaggaaaccattttagctgactgtgttac
ttgctgaagccatgtgttatgttttcattttagtgtcccaggggctacaaaaatttgttt
tttttctgcagcttgtaatacactaaagtatattttctttcttcattgacattacgtttc
caaacttcgtttttagtagatagtcccatcatttgaaagttaattttgggagttggagat
acttctgtctccaattaaccctgttttgtgcctttcttcgttttatttccttcctatttc
aggagttttgccttaatgctgtaagaaactatctttgtgttattttgagccgcatctcta
aaagggaaaagaaatttgcaaaccaaaatcttgacactttctgagaaggagggttttttg
gtagtttctccgatttggagaccttgggtatatgtcttccatattcccctgccaggtttt
ctgattgtgtatgattactccagGTAGCGCTGGTGTACGGTCAAATGAATGAACCGCCTG
GCGCTCGCGCCCGGGTGGCTCTGACTGGACTGACTGTTGCCGAATACTTCAGAGACCAAG
AGGGTCAAGATGTACTGCTCTTTATCGATAACATTTTCCGCTTCACCCAGGCTGGCTCTG
AGgtaagaagcctcgaaagaacctatttcctggacttctctatggaaaggtgcagatgag
gctaaagatgtagacacctaatacctttgttctttttcttttttttcttagGTGTCTGCT
TTATTGGGCAGGATCCCTTCTGCTGTGGGCTATCAGCCTACCTTGGCCACTGATATGGGT
ACCATGCAGGAAAGAATCACCACCACCAAGAAGGGATCTATTACCTCTGTACAGgtaaga
acaatgaaatggttgaaggtctaatttgtatagaggtatatacaggaaagtatacaacct
agttgcttatgtctcaaggttttgaccaggttaatgagctccccaaaataatgtataaaa
ttctatgtgtgcatgttagagaccctagaaggttaagaaatgctcatttgaagtagttga
agacatacaggtgaatgtggatcacaaagtagtggtttctagaaagccttaggagtttgg
agctgcatggaaaccgcattaatcatgtactgcaccaaagtgccacaccacacatctgca
gatatagatgatgtgtgtatgtgtatatatacacacatagcaagattactttgtctaaac
tgttgtgactttcagtgaacctagtgaactgctgtagtcatgcaggattttttgttttta
actgaaactgtgggtatcaataaaatagagttaaaatgggggatgaaaaacaaaaggaat
gacaatgaatctttgagcacagcttagatcatctatatgctcactcagcaggtattaggg
atgataaggctatttttgaggttgagtctcgaatgctaaaagatgatgagaggtcaaaaa
agggtggcttaaatcaaattacttggtttcctgctgctcctcatggggtcttgactcact
atagGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCAACTACTTTTGC
CCATTTGGATGCTACCACTGTGCTGTCCCGTGCTATTGCTGAGTTGGGCATCTATCCAGC
AGTGGATCCTCTGGATTCTACCTCTCGAATCATGGATCCCAACATTGTTGGAAATGAGCA
TTATGATGTTGCTCGTGGGGTACAAAAGATTCTGCAGgtgagtaatgcaggtgagatcag
tggccataaagtcatacggtgggtttttgaggacaatattaatagcaaatctttcctggt
gacctgtgtgatttgctttggagcaaggaaagatgaaattacgactttctattagtgtga
aggagaactcttgggtttccaggtacttaggtttggaatccattttctaatggcaccaga
ctagaggggaggataagaccttgatcttagctgagggccttcaggatcccaagtatgtaa
cttcactactaacttgtttactttgtgaggtaaggtgctaaaatgctttgtacaaagcgc
tgggtacaaggtggtattaacccttaggtttctgtccaaatttgaaaaaatgaatattgg
ggtgcttggctggtcagtcagtagagcatccaactcttgatatctgggttgtgagtttaa
gccccactttgggcatggagcctacttaaataaaaaaagaaaaatattttgtgtaagtat
ttattcaggcctttcttgttttctcacagGACTACAAATCTCTCCAGGACATCATTGCCA
TCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACTGTGTCCCGTGCACGGAAAA
TACAGCGTTTCTTGTCTCAGCCATTCCAAGTAGCTGAGGTTTTCACAGGTCATATGGGGA
AGCTGGTACCTCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGgtgagatta
cgtgtataaagctgaacataaaatggcagagaagctgaaatctcttgaatgctcactgtg
ctatattcccattccagcaatcatcaagcagtacataagtatattgtgtctagtcacata
attttttttttttttaaagattttatttatttatttgagagagaggcagagacacaggca
gagggagaagcaggctccatgcagggagcccgatgtgggactcgatcccggaactccagg
atcacgccctgggccaaaggcaggagctaaaccgctgagccacccgggctgtccctagtc
acataattttaaaaaataaactatttcctatcagtgttctttggaaatactctatttact
tctgagagtgaacttgtattacttggttgttgtcatttaacatttaccgagtgttttcag
acctagttattctaaatgaattacaggtccttataaggaaggcgtgattaccgtgttttt
acaaatgaggaattttttttttttttaatttttatttatttatgatagtcacagagagag
agagaggcagagacacaggcagagggagaagcaggctccatgcaccgggagcccaacgtg
ggattcgatcccgggtctccaggatcgcgccctgggccaaaggcaggcgccaaactgctg
cgctacccagggatcccacaaatgaggaatcttaacgcacagaatataaaataactggtc
ctgatatccagctgaagtaaagagtaagaatttgaatccaggttatatggccaggaccat
ttgttcttaatccatactgtattgtcttacaagttatttgtgacagaagtgtgttaaaag
atttcttggatgacacaaattcatcacattctgactggtggccccaagtggtgaagtatg
tatacactgcaaaaagttgccgcttctcaccagtggatttttttttccatatagGTGAAT
ATGACCATCTTCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAA
AAGCTGACAAGCTGGCTGAAGAGCATTCATGAGGAGGTCCTTTTGGCAAACTAAGCACTG
ATCATCCTCGGTGCTGTGCTGCTTGCCCCTAATCTAAGAAAAATCTGTTTGCTCTGTAGG
CCACATGAAAGCCTGTGTTCTGTCTGAAGAGTATTTAAAGTTTCCAATAAAATGTACATC
CCTCAGAAGTGGTCTATTTCTCTTTGTCCTGACAACACCATCAACACTAAGTTTTAGAGT
GGCCgtaagaaatagtacaaagtactgtcttgatggacaactgcaggtcttatgaggggt
tccctgcagatgatgtgatctcaatagtagggcctccactttggccctttatttggcaaa
gcaaatcaattgtttgcctcgaatatactttattcctgcttgattaaaaagcaacaggga
tattttttagaagagcatatggagaggtgatgggtctacagaatgctatactaagagcag
ggatcaatcagtgaattgaaggaatccaattttttgtaaaggatgcttctgaaggattaa
aaacctgcaaaactcaagtcaagcctgctgcctgccgcccccccccccccaggtctacct
aaggttgctttctccttgcccaccctttcaccttttttcagaaagttgttgactattgcc
tgatttatattttgggcaagcctagagttgcgtgtgatcccttgaggcagtgcatggtat
aaaataaccatgaggcctgtcctgactcctgctaaaatcctttaggaaagttggggagat
ttaatctgttacagggcatggcaatttccgggtttgtggggttggccttctaaactaaat
aatggaattaggtaatttccgcttcattttagccactaaaatggcaggtcaggagcactc
caaagtacacctatttcagtgtgaactaagtgcctagtcccagcccagtgagtggtttcc
tgaactagggcccatctcctgctgccctctggtggtaggccgggagactgcaagaactct
gatctcaccattttgaaatccataaaggccatttgctgggatgtggttcttagctaacga
ttgtttacaaaccagctggggcttttgtcctgaggaggagcctgcatctataggctccac
ccctgaggctttcaagctggatcgaagcagggcggggacaaacatcccaattcagaggcc
cccgagggctgaaggttggggaggggccttgggagagatgccag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 1592..1774, 2012..2186, 3215..3336, 3586..3770, 4283..4441, 4551..4673, 5344..5556, 6089..6290, 7254..7563
1009..1132, 1592..1774, 2012..2186, 3215..3336, 3586..3770, 4283..4441, 4551..4673, 5344..5556, 6089..6290, 7254..7351
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved